Incidental Mutation 'R9386:Col22a1'
ID 710351
Institutional Source Beutler Lab
Gene Symbol Col22a1
Ensembl Gene ENSMUSG00000079022
Gene Name collagen, type XXII, alpha 1
Synonyms C80743, 2310067L16Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9386 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 71795795-72034227 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71981945 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 256 (D256G)
Ref Sequence ENSEMBL: ENSMUSP00000125069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159993]
AlphaFold E9Q7P1
Predicted Effect probably damaging
Transcript: ENSMUST00000159993
AA Change: D256G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125069
Gene: ENSMUSG00000079022
AA Change: D256G

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
VWA 45 227 1.35e-51 SMART
TSPN 248 436 1.26e-33 SMART
low complexity region 454 470 N/A INTRINSIC
internal_repeat_3 494 555 1.96e-13 PROSPERO
internal_repeat_1 496 643 1.49e-19 PROSPERO
low complexity region 644 657 N/A INTRINSIC
low complexity region 673 707 N/A INTRINSIC
Pfam:Collagen 751 823 1.5e-9 PFAM
Pfam:Collagen 810 863 2.3e-10 PFAM
Pfam:Collagen 869 931 4.8e-11 PFAM
Pfam:Collagen 926 990 1.1e-10 PFAM
Pfam:Collagen 1031 1087 1.7e-10 PFAM
Pfam:Collagen 1104 1162 1.8e-11 PFAM
low complexity region 1173 1227 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
internal_repeat_2 1257 1348 3.25e-18 PROSPERO
internal_repeat_4 1268 1347 9.67e-7 PROSPERO
Pfam:Collagen 1389 1448 4e-10 PFAM
Pfam:Collagen 1481 1540 2.6e-9 PFAM
low complexity region 1546 1558 N/A INTRINSIC
low complexity region 1580 1590 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL22A1, a member of the FACIT (fibrillar-associated collagens with interrupted triple helices) subgroup of the collagen protein family, specifically localizes to tissue junctions (Koch et al., 2004 [PubMed 15016833]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T A 10: 10,398,964 M750L probably benign Het
Ahnak2 T A 12: 112,778,993 H673L Het
Alg1 T C 16: 5,241,337 L338P probably damaging Het
Anapc1 A C 2: 128,617,722 S1806A probably benign Het
Anks1 C T 17: 28,053,906 T925I probably benign Het
Apob G A 12: 8,006,629 A1704T probably damaging Het
Arnt G A 3: 95,488,376 V422M possibly damaging Het
Cblb C A 16: 52,166,338 S648* probably null Het
Cdk18 A G 1: 132,116,445 probably null Het
Celsr1 T C 15: 85,979,030 D1267G probably damaging Het
Chtf18 C T 17: 25,723,758 R399H probably damaging Het
Cntnap1 T A 11: 101,185,226 Y979N probably damaging Het
D10Wsu102e T C 10: 83,360,265 F3L probably benign Het
Dbn1 C T 13: 55,481,947 R174Q probably damaging Het
Dnah10 G A 5: 124,794,443 probably null Het
Dnah9 T A 11: 65,947,542 D3143V probably damaging Het
Dnajc6 G A 4: 101,636,901 probably null Het
Doxl2 A G 6: 48,975,390 N83S probably benign Het
Dsg1b A G 18: 20,392,014 N169S possibly damaging Het
Eloa A G 4: 136,010,536 V371A probably benign Het
Epb41l4b A T 4: 57,076,553 V327E probably damaging Het
Fbxo15 A T 18: 84,959,247 T140S probably benign Het
Fryl A T 5: 73,191,809 F3L unknown Het
Galnt16 T C 12: 80,598,106 V501A probably damaging Het
Gm9992 C T 17: 7,369,765 W341* probably null Het
Haus6 A G 4: 86,583,864 I590T probably benign Het
Hcfc2 T A 10: 82,739,103 F199I probably damaging Het
Hoxd13 A G 2: 74,668,983 Y225C probably damaging Het
Hydin T C 8: 110,587,730 L4282P probably benign Het
Ing2 T C 8: 47,674,526 E52G probably benign Het
Itsn2 T C 12: 4,629,730 S180P unknown Het
Kansl1l T C 1: 66,725,970 E727G probably damaging Het
Klhl26 A G 8: 70,451,506 F585L probably benign Het
Lce1a1 T G 3: 92,646,883 S95R unknown Het
Lrp1b A T 2: 41,123,628 V1955E Het
Megf6 G A 4: 154,256,077 G583E probably damaging Het
Mex3a A G 3: 88,536,198 I194V possibly damaging Het
Mmp10 A T 9: 7,503,387 Y116F probably damaging Het
Muc2 A T 7: 141,693,146 D155V probably damaging Het
Ncam2 T C 16: 81,455,364 C232R probably damaging Het
Olfr702 T C 7: 106,824,500 I9V probably benign Het
Pdgfd C A 9: 6,293,903 A159E possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Plekha8 C A 6: 54,628,861 T307K probably damaging Het
Pnpla6 T C 8: 3,521,417 probably null Het
Prkdc T G 16: 15,678,272 S776A probably damaging Het
Prrc2b T C 2: 32,214,113 I1201T probably benign Het
Pxmp4 C A 2: 154,588,084 M128I probably benign Het
Siglech T C 7: 55,772,564 S306P probably benign Het
Strc C T 2: 121,367,730 E1449K probably damaging Het
Tchh A T 3: 93,447,039 Q1262L unknown Het
Tln2 A T 9: 67,365,967 D410E possibly damaging Het
Tmem175 A T 5: 108,639,473 Q62L probably benign Het
Tpm3-rs7 A C 14: 113,315,165 M164L probably benign Het
Trav8d-2 G A 14: 53,042,763 R70H probably damaging Het
Tsc1 T C 2: 28,671,846 S332P probably benign Het
Ttc41 T G 10: 86,713,026 I28R probably damaging Het
Vsig10 A C 5: 117,325,075 Y122S probably damaging Het
Wnk2 A G 13: 49,067,346 W1260R probably damaging Het
Other mutations in Col22a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Col22a1 APN 15 71860958 critical splice donor site probably null
IGL00434:Col22a1 APN 15 72006675 missense possibly damaging 0.71
IGL00721:Col22a1 APN 15 71846177 missense unknown
IGL00902:Col22a1 APN 15 71964659 missense probably damaging 1.00
IGL01311:Col22a1 APN 15 71973637 splice site probably benign
IGL01329:Col22a1 APN 15 71907040 missense probably benign 0.02
IGL01527:Col22a1 APN 15 71907031 missense probably damaging 0.98
IGL01870:Col22a1 APN 15 71952528 missense probably benign 0.07
IGL02002:Col22a1 APN 15 71811097 splice site probably benign
IGL02248:Col22a1 APN 15 71799448 missense unknown
IGL02322:Col22a1 APN 15 71822653 missense unknown
IGL02472:Col22a1 APN 15 71827753 splice site probably benign
IGL02685:Col22a1 APN 15 71801915 missense unknown
IGL02888:Col22a1 APN 15 71846219 missense unknown
IGL02971:Col22a1 APN 15 72006738 missense probably damaging 1.00
IGL03175:Col22a1 APN 15 71969103 missense possibly damaging 0.81
IGL03240:Col22a1 APN 15 71807928 missense unknown
R0083:Col22a1 UTSW 15 71890497 missense possibly damaging 0.70
R0383:Col22a1 UTSW 15 71869004 missense unknown
R0449:Col22a1 UTSW 15 71962671 critical splice donor site probably null
R0508:Col22a1 UTSW 15 71933413 missense unknown
R0944:Col22a1 UTSW 15 71881662 missense probably benign 0.03
R1289:Col22a1 UTSW 15 71837377 missense unknown
R1436:Col22a1 UTSW 15 71922957 splice site probably benign
R1439:Col22a1 UTSW 15 71952377 splice site probably benign
R1460:Col22a1 UTSW 15 71821931 missense unknown
R1680:Col22a1 UTSW 15 71799361 missense unknown
R1715:Col22a1 UTSW 15 72006981 missense possibly damaging 0.79
R1742:Col22a1 UTSW 15 71801913 missense unknown
R1745:Col22a1 UTSW 15 72006787 missense probably damaging 1.00
R1763:Col22a1 UTSW 15 72007176 missense probably damaging 0.96
R1932:Col22a1 UTSW 15 71870140 missense unknown
R2125:Col22a1 UTSW 15 71848577 missense unknown
R2126:Col22a1 UTSW 15 71857253 nonsense probably null
R2137:Col22a1 UTSW 15 72006948 missense possibly damaging 0.46
R2860:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R2861:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R2862:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R3704:Col22a1 UTSW 15 71970307 missense probably damaging 1.00
R3778:Col22a1 UTSW 15 71973692 missense probably damaging 1.00
R3940:Col22a1 UTSW 15 71981933 nonsense probably null
R3950:Col22a1 UTSW 15 71977358 missense possibly damaging 0.90
R4240:Col22a1 UTSW 15 72007131 missense probably damaging 1.00
R4531:Col22a1 UTSW 15 72007149 missense probably damaging 1.00
R4597:Col22a1 UTSW 15 71964662 missense possibly damaging 0.83
R4604:Col22a1 UTSW 15 71952339 missense probably benign 0.36
R4654:Col22a1 UTSW 15 71973695 missense possibly damaging 0.95
R4782:Col22a1 UTSW 15 71801925 missense unknown
R4847:Col22a1 UTSW 15 71799499 missense unknown
R4980:Col22a1 UTSW 15 71801943 missense unknown
R4981:Col22a1 UTSW 15 71861066 missense unknown
R4996:Col22a1 UTSW 15 72007161 missense probably damaging 0.99
R5007:Col22a1 UTSW 15 71944422 missense probably damaging 1.00
R5135:Col22a1 UTSW 15 71799337 missense unknown
R5197:Col22a1 UTSW 15 72009406 missense probably damaging 0.96
R5292:Col22a1 UTSW 15 71970336 missense probably damaging 1.00
R5449:Col22a1 UTSW 15 71821949 missense unknown
R5480:Col22a1 UTSW 15 71964611 missense probably damaging 0.98
R5627:Col22a1 UTSW 15 71981918 missense probably damaging 0.98
R5828:Col22a1 UTSW 15 72009491 missense probably benign 0.01
R5927:Col22a1 UTSW 15 72006966 missense probably damaging 1.00
R6006:Col22a1 UTSW 15 71973836 missense probably damaging 1.00
R6245:Col22a1 UTSW 15 71973816 missense probably damaging 0.99
R6288:Col22a1 UTSW 15 71894869 critical splice acceptor site probably null
R6482:Col22a1 UTSW 15 71890489 missense possibly damaging 0.93
R6497:Col22a1 UTSW 15 71890576 missense possibly damaging 0.85
R6579:Col22a1 UTSW 15 71881653 missense probably benign 0.18
R6643:Col22a1 UTSW 15 71822037 splice site probably null
R6663:Col22a1 UTSW 15 71820059 missense unknown
R7179:Col22a1 UTSW 15 71933413 missense unknown
R7215:Col22a1 UTSW 15 71970332 nonsense probably null
R7216:Col22a1 UTSW 15 71973845 missense probably damaging 1.00
R7505:Col22a1 UTSW 15 71799399 nonsense probably null
R7585:Col22a1 UTSW 15 71892205 missense probably damaging 0.99
R7699:Col22a1 UTSW 15 71973851 missense probably damaging 1.00
R7788:Col22a1 UTSW 15 71952317 critical splice donor site probably null
R7921:Col22a1 UTSW 15 71981962 splice site probably null
R8205:Col22a1 UTSW 15 71861069 missense unknown
R8769:Col22a1 UTSW 15 72006722 missense probably benign 0.21
R8780:Col22a1 UTSW 15 72006947 missense probably damaging 0.99
R8827:Col22a1 UTSW 15 71902816 critical splice donor site probably null
R8843:Col22a1 UTSW 15 72006654 missense probably damaging 1.00
R8982:Col22a1 UTSW 15 71973638 critical splice donor site probably null
R9031:Col22a1 UTSW 15 71881674 nonsense probably null
R9036:Col22a1 UTSW 15 71890582 missense probably damaging 1.00
R9084:Col22a1 UTSW 15 71820080 missense unknown
R9281:Col22a1 UTSW 15 71861071 missense unknown
R9406:Col22a1 UTSW 15 71973692 missense probably damaging 1.00
X0066:Col22a1 UTSW 15 71801879 missense unknown
X0066:Col22a1 UTSW 15 71846200 missense unknown
Y5406:Col22a1 UTSW 15 71799515 missense unknown
Z1177:Col22a1 UTSW 15 71915120 missense unknown
Predicted Primers PCR Primer
(F):5'- GCACCACGAAGTATGCTACC -3'
(R):5'- ACATGACTCATAGCTTGGCTG -3'

Sequencing Primer
(F):5'- ACGAAGTATGCTACCATTAGCTCAG -3'
(R):5'- GACTCATAGCTTGGCTGCTCTTG -3'
Posted On 2022-04-18