Incidental Mutation 'R9387:Nbea'
ID 710371
Institutional Source Beutler Lab
Gene Symbol Nbea
Ensembl Gene ENSMUSG00000027799
Gene Name neurobeachin
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9387 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 55532616-56091122 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 55898460 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 1508 (K1508R)
Ref Sequence ENSEMBL: ENSMUSP00000029374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029374]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000029374
AA Change: K1508R

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029374
Gene: ENSMUSG00000027799
AA Change: K1508R

DomainStartEndE-ValueType
low complexity region 19 40 N/A INTRINSIC
Pfam:Laminin_G_3 228 393 2.8e-13 PFAM
Pfam:DUF4704 462 733 4e-113 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 964 969 N/A INTRINSIC
low complexity region 1781 1790 N/A INTRINSIC
low complexity region 1791 1807 N/A INTRINSIC
low complexity region 1835 1845 N/A INTRINSIC
Pfam:DUF1088 1956 2122 3.5e-91 PFAM
Pfam:PH_BEACH 2148 2245 2.6e-32 PFAM
Beach 2276 2553 1.3e-205 SMART
WD40 2659 2696 2.12e2 SMART
WD40 2699 2742 2.22e0 SMART
WD40 2759 2798 9.21e0 SMART
WD40 2842 2880 2.88e-1 SMART
WD40 2883 2922 8.91e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large, diverse group of A-kinase anchor proteins that target the activity of protein kinase A to specific subcellular sites by binding to its type II regulatory subunits. Brain-specific expression and coat protein-like membrane recruitment of a highly similar protein in mouse suggest an involvement in neuronal post-Golgi membrane traffic. Mutations in this gene may be associated with a form of autism. This gene and its expression are frequently disrupted in patients with multiple myeloma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants may exist, but their full-length nature has not been determined.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele or transgene insertion die shortly after birth, are cyanotic, and exhibit no response to tactile stimuli, no spontaneous movement, and impaired CNS synaptic transmission. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(3) Transgenic(1)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,553,255 (GRCm39) D152G probably benign Het
Abcb1b G A 5: 8,875,614 (GRCm39) V596I probably benign Het
Acss3 A G 10: 106,959,255 (GRCm39) S64P probably damaging Het
Aggf1 T C 13: 95,507,461 (GRCm39) Y108C probably damaging Het
Arpc5l T C 2: 38,903,195 (GRCm39) V73A probably benign Het
Atp5f1d A G 10: 79,981,134 (GRCm39) D126G probably damaging Het
Carmil3 T A 14: 55,731,869 (GRCm39) L199* probably null Het
Cblb A G 16: 51,853,515 (GRCm39) R44G probably benign Het
Cdcp3 A G 7: 130,863,620 (GRCm39) I1208V unknown Het
Chaf1b T G 16: 93,689,629 (GRCm39) F225V probably benign Het
Creb3l2 A T 6: 37,356,751 (GRCm39) N105K probably damaging Het
Dagla A T 19: 10,248,465 (GRCm39) I65N probably damaging Het
Dclre1c T G 2: 3,425,342 (GRCm39) F30V probably damaging Het
Dicer1 A G 12: 104,695,499 (GRCm39) V144A possibly damaging Het
Dlg5 C T 14: 24,197,168 (GRCm39) G1593D probably damaging Het
Enpp3 A T 10: 24,711,990 (GRCm39) M1K probably null Het
Fmod C A 1: 133,968,514 (GRCm39) H185N probably benign Het
Gon4l A G 3: 88,802,260 (GRCm39) E957G probably benign Het
Hat1 A G 2: 71,264,512 (GRCm39) M310V possibly damaging Het
Klhl31 A T 9: 77,557,826 (GRCm39) T181S probably benign Het
Krt36 T A 11: 99,994,906 (GRCm39) E222V probably damaging Het
Lrrc27 A T 7: 138,807,837 (GRCm39) K315* probably null Het
Mak16 T G 8: 31,650,794 (GRCm39) D232A probably damaging Het
Mepce A G 5: 137,783,322 (GRCm39) S335P possibly damaging Het
Mki67 T A 7: 135,302,378 (GRCm39) R885S probably damaging Het
Mmrn1 G A 6: 60,935,176 (GRCm39) W224* probably null Het
Mroh8 T A 2: 157,098,386 (GRCm39) Q254L possibly damaging Het
Mup18 A T 4: 61,590,854 (GRCm39) V101E probably damaging Het
Or5aq6 A T 2: 86,923,390 (GRCm39) M117K possibly damaging Het
Or5g9 A G 2: 85,551,806 (GRCm39) Y19C probably benign Het
Pcdh15 A T 10: 74,066,192 (GRCm39) I286F probably damaging Het
Pcdhb8 A T 18: 37,488,751 (GRCm39) Q143L probably benign Het
Pibf1 T C 14: 99,448,436 (GRCm39) S632P probably damaging Het
Senp6 A G 9: 79,999,646 (GRCm39) K100R probably damaging Het
Slc5a9 A G 4: 111,750,864 (GRCm39) S81P probably damaging Het
Sox8 T C 17: 25,786,338 (GRCm39) Q455R probably damaging Het
Stard13 A T 5: 151,113,483 (GRCm39) M26K probably benign Het
Sulf1 T A 1: 12,908,778 (GRCm39) M597K probably benign Het
Ugt2a3 T A 5: 87,484,832 (GRCm39) D64V probably benign Het
Unc80 T C 1: 66,589,097 (GRCm39) probably null Het
Vav3 A T 3: 109,565,291 (GRCm39) H729L probably benign Het
Vmn1r226 T A 17: 20,907,831 (GRCm39) L21Q probably damaging Het
Wdtc1 A G 4: 133,036,058 (GRCm39) probably null Het
Zfp984 A G 4: 147,840,002 (GRCm39) M283T probably benign Het
Zik1 A G 7: 10,224,623 (GRCm39) L158P probably damaging Het
Other mutations in Nbea
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Nbea APN 3 55,535,914 (GRCm39) missense probably damaging 1.00
IGL00541:Nbea APN 3 55,875,510 (GRCm39) missense probably benign 0.02
IGL00584:Nbea APN 3 55,989,869 (GRCm39) missense probably damaging 0.98
IGL00648:Nbea APN 3 55,916,681 (GRCm39) missense probably damaging 0.98
IGL00785:Nbea APN 3 55,862,814 (GRCm39) missense probably benign
IGL00899:Nbea APN 3 55,550,266 (GRCm39) missense probably benign 0.32
IGL00955:Nbea APN 3 55,912,893 (GRCm39) missense possibly damaging 0.45
IGL01296:Nbea APN 3 55,938,957 (GRCm39) missense probably benign 0.04
IGL01299:Nbea APN 3 55,598,315 (GRCm39) missense probably damaging 1.00
IGL01393:Nbea APN 3 55,912,729 (GRCm39) missense probably benign 0.02
IGL01550:Nbea APN 3 55,712,669 (GRCm39) missense possibly damaging 0.93
IGL02023:Nbea APN 3 55,588,437 (GRCm39) missense probably damaging 1.00
IGL02034:Nbea APN 3 55,875,577 (GRCm39) missense probably damaging 1.00
IGL02061:Nbea APN 3 55,625,308 (GRCm39) missense possibly damaging 0.54
IGL02082:Nbea APN 3 55,875,588 (GRCm39) missense possibly damaging 0.88
IGL02113:Nbea APN 3 55,899,913 (GRCm39) missense probably benign
IGL02188:Nbea APN 3 55,891,258 (GRCm39) missense probably benign 0.00
IGL02319:Nbea APN 3 55,893,159 (GRCm39) missense probably damaging 1.00
IGL02406:Nbea APN 3 55,993,687 (GRCm39) missense probably benign 0.02
IGL02494:Nbea APN 3 55,712,772 (GRCm39) missense probably benign 0.02
IGL02550:Nbea APN 3 55,926,835 (GRCm39) missense probably damaging 0.98
IGL02706:Nbea APN 3 55,944,699 (GRCm39) missense probably damaging 1.00
IGL02718:Nbea APN 3 55,539,483 (GRCm39) nonsense probably null
IGL02822:Nbea APN 3 55,926,868 (GRCm39) missense possibly damaging 0.93
IGL02885:Nbea APN 3 55,539,407 (GRCm39) missense probably benign 0.01
IGL03000:Nbea APN 3 55,912,048 (GRCm39) missense possibly damaging 0.94
IGL03081:Nbea APN 3 55,987,339 (GRCm39) missense probably damaging 1.00
IGL03091:Nbea APN 3 55,992,725 (GRCm39) missense probably damaging 1.00
IGL03368:Nbea APN 3 55,987,351 (GRCm39) missense probably damaging 0.98
Neches UTSW 3 55,860,455 (GRCm39) critical splice donor site probably null
scotland UTSW 3 55,534,329 (GRCm39) missense probably damaging 1.00
Wales UTSW 3 55,998,540 (GRCm39) missense probably damaging 1.00
FR4340:Nbea UTSW 3 55,916,633 (GRCm39) critical splice donor site probably benign
G4846:Nbea UTSW 3 55,994,918 (GRCm39) missense probably damaging 0.98
IGL02835:Nbea UTSW 3 55,625,290 (GRCm39) missense possibly damaging 0.88
LCD18:Nbea UTSW 3 55,608,948 (GRCm39) intron probably benign
R0087:Nbea UTSW 3 55,998,444 (GRCm39) missense possibly damaging 0.92
R0220:Nbea UTSW 3 55,912,724 (GRCm39) missense probably benign 0.30
R0324:Nbea UTSW 3 55,965,369 (GRCm39) critical splice donor site probably null
R0330:Nbea UTSW 3 55,550,238 (GRCm39) missense probably benign 0.27
R0391:Nbea UTSW 3 55,944,698 (GRCm39) missense probably damaging 1.00
R0394:Nbea UTSW 3 55,937,328 (GRCm39) missense probably damaging 1.00
R0419:Nbea UTSW 3 55,726,715 (GRCm39) missense probably benign 0.05
R0503:Nbea UTSW 3 55,550,257 (GRCm39) missense possibly damaging 0.79
R0521:Nbea UTSW 3 55,915,689 (GRCm39) missense probably damaging 1.00
R0595:Nbea UTSW 3 55,535,917 (GRCm39) missense probably benign 0.18
R0894:Nbea UTSW 3 55,916,761 (GRCm39) missense possibly damaging 0.89
R1072:Nbea UTSW 3 55,993,617 (GRCm39) missense possibly damaging 0.94
R1125:Nbea UTSW 3 55,764,427 (GRCm39) nonsense probably null
R1169:Nbea UTSW 3 55,875,744 (GRCm39) missense probably benign 0.00
R1241:Nbea UTSW 3 55,965,461 (GRCm39) missense probably damaging 1.00
R1269:Nbea UTSW 3 55,912,202 (GRCm39) missense probably benign 0.05
R1406:Nbea UTSW 3 55,944,702 (GRCm39) missense probably benign 0.00
R1406:Nbea UTSW 3 55,944,702 (GRCm39) missense probably benign 0.00
R1457:Nbea UTSW 3 55,992,748 (GRCm39) missense probably damaging 1.00
R1482:Nbea UTSW 3 55,987,414 (GRCm39) missense probably damaging 1.00
R1483:Nbea UTSW 3 55,910,211 (GRCm39) missense probably benign 0.25
R1502:Nbea UTSW 3 55,912,310 (GRCm39) missense probably benign 0.03
R1544:Nbea UTSW 3 55,966,248 (GRCm39) missense probably damaging 0.99
R1629:Nbea UTSW 3 55,910,312 (GRCm39) missense possibly damaging 0.52
R1647:Nbea UTSW 3 55,537,650 (GRCm39) missense probably damaging 0.97
R1663:Nbea UTSW 3 55,553,407 (GRCm39) missense possibly damaging 0.95
R1722:Nbea UTSW 3 55,573,116 (GRCm39) missense probably damaging 1.00
R1757:Nbea UTSW 3 55,537,610 (GRCm39) missense possibly damaging 0.83
R1771:Nbea UTSW 3 55,841,940 (GRCm39) missense probably benign 0.00
R1796:Nbea UTSW 3 55,551,129 (GRCm39) missense possibly damaging 0.48
R1844:Nbea UTSW 3 55,989,857 (GRCm39) missense probably damaging 0.97
R1872:Nbea UTSW 3 55,550,310 (GRCm39) missense probably benign 0.12
R1938:Nbea UTSW 3 55,992,743 (GRCm39) missense probably damaging 1.00
R1940:Nbea UTSW 3 55,860,521 (GRCm39) missense possibly damaging 0.78
R2062:Nbea UTSW 3 55,993,578 (GRCm39) splice site probably benign
R2066:Nbea UTSW 3 55,875,567 (GRCm39) missense probably damaging 1.00
R2097:Nbea UTSW 3 55,630,638 (GRCm39) missense probably damaging 0.96
R2181:Nbea UTSW 3 55,937,360 (GRCm39) missense possibly damaging 0.92
R2274:Nbea UTSW 3 55,895,506 (GRCm39) splice site probably null
R2345:Nbea UTSW 3 55,992,700 (GRCm39) missense probably damaging 1.00
R2423:Nbea UTSW 3 55,992,727 (GRCm39) missense probably damaging 1.00
R2434:Nbea UTSW 3 55,554,881 (GRCm39) missense possibly damaging 0.91
R2880:Nbea UTSW 3 55,554,779 (GRCm39) missense probably benign 0.04
R2881:Nbea UTSW 3 55,554,779 (GRCm39) missense probably benign 0.04
R2940:Nbea UTSW 3 55,842,045 (GRCm39) missense probably benign 0.24
R3500:Nbea UTSW 3 55,588,431 (GRCm39) missense possibly damaging 0.88
R3765:Nbea UTSW 3 55,912,970 (GRCm39) missense probably damaging 1.00
R3790:Nbea UTSW 3 55,912,450 (GRCm39) missense probably benign
R3808:Nbea UTSW 3 55,625,269 (GRCm39) missense probably benign 0.02
R3845:Nbea UTSW 3 55,993,713 (GRCm39) splice site probably benign
R4182:Nbea UTSW 3 55,915,848 (GRCm39) missense probably damaging 0.99
R4385:Nbea UTSW 3 55,908,059 (GRCm39) missense possibly damaging 0.77
R4419:Nbea UTSW 3 55,917,021 (GRCm39) missense probably damaging 1.00
R4426:Nbea UTSW 3 55,989,800 (GRCm39) missense probably damaging 0.98
R4451:Nbea UTSW 3 55,899,753 (GRCm39) critical splice donor site probably null
R4456:Nbea UTSW 3 55,551,205 (GRCm39) missense probably benign 0.00
R4604:Nbea UTSW 3 55,631,069 (GRCm39) missense probably benign 0.18
R4687:Nbea UTSW 3 55,965,486 (GRCm39) missense probably damaging 1.00
R4758:Nbea UTSW 3 55,912,824 (GRCm39) missense probably benign
R4840:Nbea UTSW 3 55,618,091 (GRCm39) missense probably benign 0.37
R4888:Nbea UTSW 3 55,912,776 (GRCm39) missense possibly damaging 0.61
R4954:Nbea UTSW 3 55,943,379 (GRCm39) missense probably damaging 1.00
R4972:Nbea UTSW 3 55,992,667 (GRCm39) missense probably damaging 0.99
R4980:Nbea UTSW 3 55,860,466 (GRCm39) missense probably benign 0.00
R4980:Nbea UTSW 3 55,554,772 (GRCm39) splice site probably null
R5104:Nbea UTSW 3 55,987,348 (GRCm39) missense probably damaging 1.00
R5139:Nbea UTSW 3 55,534,384 (GRCm39) missense possibly damaging 0.90
R5166:Nbea UTSW 3 55,926,874 (GRCm39) missense probably damaging 1.00
R5347:Nbea UTSW 3 55,948,297 (GRCm39) missense probably damaging 1.00
R5350:Nbea UTSW 3 55,926,845 (GRCm39) missense probably damaging 1.00
R5418:Nbea UTSW 3 55,553,410 (GRCm39) missense possibly damaging 0.86
R5586:Nbea UTSW 3 55,539,392 (GRCm39) missense probably benign 0.08
R5627:Nbea UTSW 3 55,899,766 (GRCm39) missense probably damaging 1.00
R5683:Nbea UTSW 3 55,536,007 (GRCm39) missense possibly damaging 0.53
R5765:Nbea UTSW 3 55,912,719 (GRCm39) missense probably benign 0.15
R5853:Nbea UTSW 3 55,899,822 (GRCm39) missense probably damaging 1.00
R5858:Nbea UTSW 3 55,860,455 (GRCm39) critical splice donor site probably null
R5955:Nbea UTSW 3 55,588,404 (GRCm39) missense probably benign 0.00
R5976:Nbea UTSW 3 55,761,268 (GRCm39) missense probably benign 0.30
R6039:Nbea UTSW 3 55,912,538 (GRCm39) missense probably benign 0.00
R6039:Nbea UTSW 3 55,912,538 (GRCm39) missense probably benign 0.00
R6043:Nbea UTSW 3 55,693,896 (GRCm39) missense probably benign 0.32
R6122:Nbea UTSW 3 55,937,317 (GRCm39) missense probably damaging 1.00
R6218:Nbea UTSW 3 55,535,905 (GRCm39) missense probably damaging 0.97
R6331:Nbea UTSW 3 55,908,037 (GRCm39) missense possibly damaging 0.94
R6334:Nbea UTSW 3 55,944,570 (GRCm39) missense probably damaging 1.00
R6393:Nbea UTSW 3 55,998,540 (GRCm39) missense probably damaging 1.00
R6411:Nbea UTSW 3 55,712,778 (GRCm39) missense probably benign 0.01
R6457:Nbea UTSW 3 55,907,990 (GRCm39) missense probably damaging 1.00
R6476:Nbea UTSW 3 55,912,227 (GRCm39) missense probably benign 0.00
R6488:Nbea UTSW 3 55,625,264 (GRCm39) missense probably damaging 0.99
R6700:Nbea UTSW 3 55,989,869 (GRCm39) missense possibly damaging 0.89
R6702:Nbea UTSW 3 55,912,923 (GRCm39) missense probably benign 0.06
R6752:Nbea UTSW 3 55,944,640 (GRCm39) missense probably benign
R6752:Nbea UTSW 3 55,875,730 (GRCm39) missense probably benign 0.02
R6804:Nbea UTSW 3 55,994,874 (GRCm39) missense probably benign 0.37
R6901:Nbea UTSW 3 55,926,836 (GRCm39) missense probably damaging 1.00
R6933:Nbea UTSW 3 55,631,031 (GRCm39) missense possibly damaging 0.63
R7124:Nbea UTSW 3 55,899,865 (GRCm39) missense probably damaging 1.00
R7211:Nbea UTSW 3 55,912,322 (GRCm39) missense probably benign 0.05
R7308:Nbea UTSW 3 55,998,452 (GRCm39) missense probably damaging 1.00
R7405:Nbea UTSW 3 55,712,687 (GRCm39) missense possibly damaging 0.94
R7669:Nbea UTSW 3 55,625,200 (GRCm39) missense probably damaging 1.00
R7762:Nbea UTSW 3 55,557,126 (GRCm39) missense probably damaging 1.00
R7833:Nbea UTSW 3 55,910,218 (GRCm39) missense probably damaging 1.00
R7885:Nbea UTSW 3 55,573,110 (GRCm39) missense probably damaging 0.97
R7935:Nbea UTSW 3 55,966,086 (GRCm39) missense probably damaging 1.00
R8050:Nbea UTSW 3 55,895,402 (GRCm39) missense probably damaging 0.99
R8108:Nbea UTSW 3 55,726,736 (GRCm39) missense probably benign 0.11
R8290:Nbea UTSW 3 55,966,056 (GRCm39) nonsense probably null
R8314:Nbea UTSW 3 55,916,672 (GRCm39) missense probably damaging 0.99
R8321:Nbea UTSW 3 56,090,518 (GRCm39) missense possibly damaging 0.86
R8376:Nbea UTSW 3 55,551,076 (GRCm39) missense possibly damaging 0.79
R8410:Nbea UTSW 3 55,944,684 (GRCm39) missense probably damaging 1.00
R8556:Nbea UTSW 3 55,554,807 (GRCm39) missense probably benign 0.25
R8753:Nbea UTSW 3 55,534,329 (GRCm39) missense probably damaging 1.00
R8844:Nbea UTSW 3 55,998,415 (GRCm39) missense probably damaging 0.97
R8884:Nbea UTSW 3 55,712,720 (GRCm39) missense probably benign 0.00
R8886:Nbea UTSW 3 55,966,148 (GRCm39) missense probably damaging 1.00
R8890:Nbea UTSW 3 55,926,784 (GRCm39) splice site probably benign
R9004:Nbea UTSW 3 55,910,359 (GRCm39) missense probably benign 0.01
R9022:Nbea UTSW 3 55,551,110 (GRCm39) missense possibly damaging 0.79
R9080:Nbea UTSW 3 55,912,516 (GRCm39) nonsense probably null
R9087:Nbea UTSW 3 55,550,157 (GRCm39) critical splice donor site probably null
R9104:Nbea UTSW 3 55,862,809 (GRCm39) missense probably benign
R9165:Nbea UTSW 3 55,912,289 (GRCm39) missense probably benign 0.15
R9219:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9221:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9222:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9260:Nbea UTSW 3 55,891,233 (GRCm39) missense possibly damaging 0.50
R9263:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9265:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9294:Nbea UTSW 3 55,998,513 (GRCm39) missense probably benign 0.00
R9360:Nbea UTSW 3 55,943,319 (GRCm39) missense possibly damaging 0.96
R9428:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9435:Nbea UTSW 3 55,943,309 (GRCm39) missense possibly damaging 0.63
R9507:Nbea UTSW 3 55,573,011 (GRCm39) missense probably damaging 1.00
R9514:Nbea UTSW 3 55,937,366 (GRCm39) missense probably damaging 1.00
R9516:Nbea UTSW 3 55,937,366 (GRCm39) missense probably damaging 1.00
R9674:Nbea UTSW 3 55,966,183 (GRCm39) missense probably damaging 1.00
R9688:Nbea UTSW 3 55,557,165 (GRCm39) missense probably benign 0.42
R9709:Nbea UTSW 3 55,693,879 (GRCm39) nonsense probably null
RF051:Nbea UTSW 3 55,916,633 (GRCm39) critical splice donor site probably benign
X0018:Nbea UTSW 3 55,943,469 (GRCm39) missense probably benign 0.39
Z1088:Nbea UTSW 3 55,630,584 (GRCm39) missense probably benign 0.34
Z1177:Nbea UTSW 3 55,938,971 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACCTAGTTCTGTGTGCCAATG -3'
(R):5'- AGGGCCATGTCAACAATTTATG -3'

Sequencing Primer
(F):5'- GTGCCAATGTAAGTTTTAAAAACCC -3'
(R):5'- AAGCAAATCTTCCCACGG -3'
Posted On 2022-04-18