Incidental Mutation 'R9387:Ugt2a3'
ID 710378
Institutional Source Beutler Lab
Gene Symbol Ugt2a3
Ensembl Gene ENSMUSG00000035780
Gene Name UDP glucuronosyltransferase 2 family, polypeptide A3
Synonyms 2010321J07Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R9387 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 87472831-87485054 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 87484832 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 64 (D64V)
Ref Sequence ENSEMBL: ENSMUSP00000031195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031195]
AlphaFold Q8BWQ1
Predicted Effect probably benign
Transcript: ENSMUST00000031195
AA Change: D64V

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000031195
Gene: ENSMUSG00000035780
AA Change: D64V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:UDPGT 24 526 1.2e-233 PFAM
Pfam:Glyco_tran_28_C 318 454 1.5e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,553,255 (GRCm39) D152G probably benign Het
Abcb1b G A 5: 8,875,614 (GRCm39) V596I probably benign Het
Acss3 A G 10: 106,959,255 (GRCm39) S64P probably damaging Het
Aggf1 T C 13: 95,507,461 (GRCm39) Y108C probably damaging Het
Arpc5l T C 2: 38,903,195 (GRCm39) V73A probably benign Het
Atp5f1d A G 10: 79,981,134 (GRCm39) D126G probably damaging Het
Carmil3 T A 14: 55,731,869 (GRCm39) L199* probably null Het
Cblb A G 16: 51,853,515 (GRCm39) R44G probably benign Het
Cdcp3 A G 7: 130,863,620 (GRCm39) I1208V unknown Het
Chaf1b T G 16: 93,689,629 (GRCm39) F225V probably benign Het
Creb3l2 A T 6: 37,356,751 (GRCm39) N105K probably damaging Het
Dagla A T 19: 10,248,465 (GRCm39) I65N probably damaging Het
Dclre1c T G 2: 3,425,342 (GRCm39) F30V probably damaging Het
Dicer1 A G 12: 104,695,499 (GRCm39) V144A possibly damaging Het
Dlg5 C T 14: 24,197,168 (GRCm39) G1593D probably damaging Het
Enpp3 A T 10: 24,711,990 (GRCm39) M1K probably null Het
Fmod C A 1: 133,968,514 (GRCm39) H185N probably benign Het
Gon4l A G 3: 88,802,260 (GRCm39) E957G probably benign Het
Hat1 A G 2: 71,264,512 (GRCm39) M310V possibly damaging Het
Klhl31 A T 9: 77,557,826 (GRCm39) T181S probably benign Het
Krt36 T A 11: 99,994,906 (GRCm39) E222V probably damaging Het
Lrrc27 A T 7: 138,807,837 (GRCm39) K315* probably null Het
Mak16 T G 8: 31,650,794 (GRCm39) D232A probably damaging Het
Mepce A G 5: 137,783,322 (GRCm39) S335P possibly damaging Het
Mki67 T A 7: 135,302,378 (GRCm39) R885S probably damaging Het
Mmrn1 G A 6: 60,935,176 (GRCm39) W224* probably null Het
Mroh8 T A 2: 157,098,386 (GRCm39) Q254L possibly damaging Het
Mup18 A T 4: 61,590,854 (GRCm39) V101E probably damaging Het
Nbea T C 3: 55,898,460 (GRCm39) K1508R probably benign Het
Or5aq6 A T 2: 86,923,390 (GRCm39) M117K possibly damaging Het
Or5g9 A G 2: 85,551,806 (GRCm39) Y19C probably benign Het
Pcdh15 A T 10: 74,066,192 (GRCm39) I286F probably damaging Het
Pcdhb8 A T 18: 37,488,751 (GRCm39) Q143L probably benign Het
Pibf1 T C 14: 99,448,436 (GRCm39) S632P probably damaging Het
Senp6 A G 9: 79,999,646 (GRCm39) K100R probably damaging Het
Slc5a9 A G 4: 111,750,864 (GRCm39) S81P probably damaging Het
Sox8 T C 17: 25,786,338 (GRCm39) Q455R probably damaging Het
Stard13 A T 5: 151,113,483 (GRCm39) M26K probably benign Het
Sulf1 T A 1: 12,908,778 (GRCm39) M597K probably benign Het
Unc80 T C 1: 66,589,097 (GRCm39) probably null Het
Vav3 A T 3: 109,565,291 (GRCm39) H729L probably benign Het
Vmn1r226 T A 17: 20,907,831 (GRCm39) L21Q probably damaging Het
Wdtc1 A G 4: 133,036,058 (GRCm39) probably null Het
Zfp984 A G 4: 147,840,002 (GRCm39) M283T probably benign Het
Zik1 A G 7: 10,224,623 (GRCm39) L158P probably damaging Het
Other mutations in Ugt2a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Ugt2a3 APN 5 87,473,514 (GRCm39) missense probably damaging 0.99
IGL00542:Ugt2a3 APN 5 87,484,682 (GRCm39) missense possibly damaging 0.61
IGL01335:Ugt2a3 APN 5 87,484,644 (GRCm39) missense probably damaging 1.00
IGL01369:Ugt2a3 APN 5 87,474,979 (GRCm39) missense probably damaging 1.00
IGL01808:Ugt2a3 APN 5 87,473,414 (GRCm39) missense probably benign 0.09
IGL02380:Ugt2a3 APN 5 87,484,658 (GRCm39) missense probably benign 0.09
IGL03245:Ugt2a3 APN 5 87,484,439 (GRCm39) missense probably damaging 1.00
IGL03260:Ugt2a3 APN 5 87,484,439 (GRCm39) missense probably damaging 1.00
IGL03261:Ugt2a3 APN 5 87,484,439 (GRCm39) missense probably damaging 1.00
IGL03280:Ugt2a3 APN 5 87,484,439 (GRCm39) missense probably damaging 1.00
IGL03302:Ugt2a3 APN 5 87,484,439 (GRCm39) missense probably damaging 1.00
D4186:Ugt2a3 UTSW 5 87,329,613 (GRCm38) missense probably damaging 1.00
R0051:Ugt2a3 UTSW 5 87,484,865 (GRCm39) missense probably damaging 1.00
R0103:Ugt2a3 UTSW 5 87,484,577 (GRCm39) missense possibly damaging 0.89
R0103:Ugt2a3 UTSW 5 87,484,577 (GRCm39) missense possibly damaging 0.89
R0324:Ugt2a3 UTSW 5 87,474,932 (GRCm39) critical splice donor site probably null
R0401:Ugt2a3 UTSW 5 87,484,349 (GRCm39) missense probably benign 0.03
R0506:Ugt2a3 UTSW 5 87,484,508 (GRCm39) missense possibly damaging 0.78
R0903:Ugt2a3 UTSW 5 87,475,570 (GRCm39) missense probably benign 0.00
R0940:Ugt2a3 UTSW 5 87,475,065 (GRCm39) missense possibly damaging 0.95
R1121:Ugt2a3 UTSW 5 87,475,548 (GRCm39) missense probably damaging 0.99
R1296:Ugt2a3 UTSW 5 87,475,005 (GRCm39) missense probably damaging 0.96
R1527:Ugt2a3 UTSW 5 87,473,457 (GRCm39) missense probably damaging 1.00
R2104:Ugt2a3 UTSW 5 87,477,541 (GRCm39) splice site probably null
R2119:Ugt2a3 UTSW 5 87,484,430 (GRCm39) missense probably damaging 0.98
R2374:Ugt2a3 UTSW 5 87,475,050 (GRCm39) missense probably damaging 1.00
R3082:Ugt2a3 UTSW 5 87,473,534 (GRCm39) missense probably benign 0.05
R3853:Ugt2a3 UTSW 5 87,485,018 (GRCm39) missense
R3894:Ugt2a3 UTSW 5 87,477,449 (GRCm39) missense probably benign 0.09
R4063:Ugt2a3 UTSW 5 87,484,725 (GRCm39) missense probably benign 0.04
R4274:Ugt2a3 UTSW 5 87,475,548 (GRCm39) missense probably damaging 0.99
R4739:Ugt2a3 UTSW 5 87,475,054 (GRCm39) missense probably damaging 0.97
R4879:Ugt2a3 UTSW 5 87,479,144 (GRCm39) missense probably benign 0.06
R5327:Ugt2a3 UTSW 5 87,479,174 (GRCm39) missense probably damaging 1.00
R5508:Ugt2a3 UTSW 5 87,475,059 (GRCm39) missense probably damaging 0.98
R5866:Ugt2a3 UTSW 5 87,484,406 (GRCm39) missense probably damaging 1.00
R6026:Ugt2a3 UTSW 5 87,484,336 (GRCm39) missense probably benign 0.00
R6268:Ugt2a3 UTSW 5 87,477,472 (GRCm39) missense probably damaging 1.00
R6807:Ugt2a3 UTSW 5 87,484,617 (GRCm39) missense probably benign 0.00
R6980:Ugt2a3 UTSW 5 87,473,491 (GRCm39) missense probably damaging 1.00
R7056:Ugt2a3 UTSW 5 87,484,953 (GRCm39) missense probably damaging 0.98
R7133:Ugt2a3 UTSW 5 87,473,393 (GRCm39) missense possibly damaging 0.61
R7477:Ugt2a3 UTSW 5 87,484,479 (GRCm39) missense possibly damaging 0.90
R7485:Ugt2a3 UTSW 5 87,475,539 (GRCm39) critical splice donor site probably null
R7798:Ugt2a3 UTSW 5 87,475,582 (GRCm39) missense probably damaging 1.00
R7957:Ugt2a3 UTSW 5 87,475,050 (GRCm39) missense probably damaging 1.00
R8803:Ugt2a3 UTSW 5 87,484,389 (GRCm39) missense probably damaging 0.98
R8886:Ugt2a3 UTSW 5 87,484,358 (GRCm39) missense probably damaging 1.00
R8944:Ugt2a3 UTSW 5 87,473,417 (GRCm39) missense possibly damaging 0.81
R9447:Ugt2a3 UTSW 5 87,473,330 (GRCm39) missense probably benign 0.39
R9524:Ugt2a3 UTSW 5 87,485,018 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CATCCCGTAGCTTGTCCATG -3'
(R):5'- GAGGAGGCACAATATGGTCTCTG -3'

Sequencing Primer
(F):5'- CCGTAGCTTGTCCATGAATTTCTGG -3'
(R):5'- CTCTGAAAAATGTGTTGCGGC -3'
Posted On 2022-04-18