Incidental Mutation 'R9387:Mmrn1'
ID 710382
Institutional Source Beutler Lab
Gene Symbol Mmrn1
Ensembl Gene ENSMUSG00000054641
Gene Name multimerin 1
Synonyms Emilin4, 4921530G03Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9387 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 60921301-60966362 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 60935176 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 224 (W224*)
Ref Sequence ENSEMBL: ENSMUSP00000119609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000129603
AA Change: W224*
SMART Domains Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: W224*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 3.3e-12 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1026 1059 1.62e-5 SMART
C1Q 1076 1210 6.74e-49 SMART
Predicted Effect probably null
Transcript: ENSMUST00000204333
AA Change: W224*
SMART Domains Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641
AA Change: W224*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 7.7e-13 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1025 1058 1.62e-5 SMART
C1Q 1075 1209 6.74e-49 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,553,255 (GRCm39) D152G probably benign Het
Abcb1b G A 5: 8,875,614 (GRCm39) V596I probably benign Het
Acss3 A G 10: 106,959,255 (GRCm39) S64P probably damaging Het
Aggf1 T C 13: 95,507,461 (GRCm39) Y108C probably damaging Het
Arpc5l T C 2: 38,903,195 (GRCm39) V73A probably benign Het
Atp5f1d A G 10: 79,981,134 (GRCm39) D126G probably damaging Het
Carmil3 T A 14: 55,731,869 (GRCm39) L199* probably null Het
Cblb A G 16: 51,853,515 (GRCm39) R44G probably benign Het
Cdcp3 A G 7: 130,863,620 (GRCm39) I1208V unknown Het
Chaf1b T G 16: 93,689,629 (GRCm39) F225V probably benign Het
Creb3l2 A T 6: 37,356,751 (GRCm39) N105K probably damaging Het
Dagla A T 19: 10,248,465 (GRCm39) I65N probably damaging Het
Dclre1c T G 2: 3,425,342 (GRCm39) F30V probably damaging Het
Dicer1 A G 12: 104,695,499 (GRCm39) V144A possibly damaging Het
Dlg5 C T 14: 24,197,168 (GRCm39) G1593D probably damaging Het
Enpp3 A T 10: 24,711,990 (GRCm39) M1K probably null Het
Fmod C A 1: 133,968,514 (GRCm39) H185N probably benign Het
Gon4l A G 3: 88,802,260 (GRCm39) E957G probably benign Het
Hat1 A G 2: 71,264,512 (GRCm39) M310V possibly damaging Het
Klhl31 A T 9: 77,557,826 (GRCm39) T181S probably benign Het
Krt36 T A 11: 99,994,906 (GRCm39) E222V probably damaging Het
Lrrc27 A T 7: 138,807,837 (GRCm39) K315* probably null Het
Mak16 T G 8: 31,650,794 (GRCm39) D232A probably damaging Het
Mepce A G 5: 137,783,322 (GRCm39) S335P possibly damaging Het
Mki67 T A 7: 135,302,378 (GRCm39) R885S probably damaging Het
Mroh8 T A 2: 157,098,386 (GRCm39) Q254L possibly damaging Het
Mup18 A T 4: 61,590,854 (GRCm39) V101E probably damaging Het
Nbea T C 3: 55,898,460 (GRCm39) K1508R probably benign Het
Or5aq6 A T 2: 86,923,390 (GRCm39) M117K possibly damaging Het
Or5g9 A G 2: 85,551,806 (GRCm39) Y19C probably benign Het
Pcdh15 A T 10: 74,066,192 (GRCm39) I286F probably damaging Het
Pcdhb8 A T 18: 37,488,751 (GRCm39) Q143L probably benign Het
Pibf1 T C 14: 99,448,436 (GRCm39) S632P probably damaging Het
Senp6 A G 9: 79,999,646 (GRCm39) K100R probably damaging Het
Slc5a9 A G 4: 111,750,864 (GRCm39) S81P probably damaging Het
Sox8 T C 17: 25,786,338 (GRCm39) Q455R probably damaging Het
Stard13 A T 5: 151,113,483 (GRCm39) M26K probably benign Het
Sulf1 T A 1: 12,908,778 (GRCm39) M597K probably benign Het
Ugt2a3 T A 5: 87,484,832 (GRCm39) D64V probably benign Het
Unc80 T C 1: 66,589,097 (GRCm39) probably null Het
Vav3 A T 3: 109,565,291 (GRCm39) H729L probably benign Het
Vmn1r226 T A 17: 20,907,831 (GRCm39) L21Q probably damaging Het
Wdtc1 A G 4: 133,036,058 (GRCm39) probably null Het
Zfp984 A G 4: 147,840,002 (GRCm39) M283T probably benign Het
Zik1 A G 7: 10,224,623 (GRCm39) L158P probably damaging Het
Other mutations in Mmrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Mmrn1 APN 6 60,954,497 (GRCm39) missense probably benign
IGL00742:Mmrn1 APN 6 60,935,104 (GRCm39) missense probably damaging 1.00
IGL00917:Mmrn1 APN 6 60,952,894 (GRCm39) nonsense probably null
IGL01121:Mmrn1 APN 6 60,952,928 (GRCm39) missense possibly damaging 0.46
IGL01393:Mmrn1 APN 6 60,937,692 (GRCm39) splice site probably benign
IGL01697:Mmrn1 APN 6 60,953,477 (GRCm39) missense possibly damaging 0.46
IGL01737:Mmrn1 APN 6 60,954,145 (GRCm39) missense probably benign
IGL01944:Mmrn1 APN 6 60,948,167 (GRCm39) critical splice donor site probably null
IGL01987:Mmrn1 APN 6 60,921,557 (GRCm39) missense probably benign 0.31
IGL02005:Mmrn1 APN 6 60,937,728 (GRCm39) missense probably damaging 1.00
IGL02190:Mmrn1 APN 6 60,964,177 (GRCm39) missense probably benign 0.13
IGL02335:Mmrn1 APN 6 60,954,131 (GRCm39) missense possibly damaging 0.79
IGL02421:Mmrn1 APN 6 60,921,806 (GRCm39) missense probably benign 0.00
IGL02530:Mmrn1 APN 6 60,935,160 (GRCm39) missense possibly damaging 0.73
IGL02709:Mmrn1 APN 6 60,950,030 (GRCm39) missense probably damaging 1.00
IGL03139:Mmrn1 APN 6 60,953,324 (GRCm39) missense probably damaging 0.99
IGL03228:Mmrn1 APN 6 60,921,876 (GRCm39) missense probably benign 0.02
IGL03272:Mmrn1 APN 6 60,965,419 (GRCm39) missense probably damaging 1.00
IGL03410:Mmrn1 APN 6 60,952,819 (GRCm39) missense probably benign 0.36
H8562:Mmrn1 UTSW 6 60,935,164 (GRCm39) missense probably damaging 0.98
K2124:Mmrn1 UTSW 6 60,953,017 (GRCm39) missense possibly damaging 0.87
R0145:Mmrn1 UTSW 6 60,949,994 (GRCm39) missense probably damaging 1.00
R0164:Mmrn1 UTSW 6 60,952,799 (GRCm39) splice site probably benign
R0352:Mmrn1 UTSW 6 60,921,955 (GRCm39) missense probably benign 0.03
R0400:Mmrn1 UTSW 6 60,954,099 (GRCm39) missense probably benign 0.00
R0538:Mmrn1 UTSW 6 60,953,453 (GRCm39) missense probably benign 0.00
R0907:Mmrn1 UTSW 6 60,950,103 (GRCm39) missense probably benign 0.09
R1117:Mmrn1 UTSW 6 60,953,309 (GRCm39) missense possibly damaging 0.51
R1383:Mmrn1 UTSW 6 60,953,306 (GRCm39) missense probably damaging 1.00
R1542:Mmrn1 UTSW 6 60,922,102 (GRCm39) missense probably damaging 0.98
R1591:Mmrn1 UTSW 6 60,921,755 (GRCm39) nonsense probably null
R1599:Mmrn1 UTSW 6 60,922,021 (GRCm39) missense probably benign
R1733:Mmrn1 UTSW 6 60,954,085 (GRCm39) missense probably benign 0.00
R2005:Mmrn1 UTSW 6 60,953,068 (GRCm39) missense possibly damaging 0.88
R2056:Mmrn1 UTSW 6 60,921,789 (GRCm39) missense probably benign 0.00
R2144:Mmrn1 UTSW 6 60,922,059 (GRCm39) missense possibly damaging 0.54
R2299:Mmrn1 UTSW 6 60,953,425 (GRCm39) missense probably damaging 0.99
R3836:Mmrn1 UTSW 6 60,921,831 (GRCm39) missense probably benign
R3837:Mmrn1 UTSW 6 60,921,831 (GRCm39) missense probably benign
R4206:Mmrn1 UTSW 6 60,935,164 (GRCm39) missense probably damaging 0.98
R4414:Mmrn1 UTSW 6 60,921,570 (GRCm39) missense probably damaging 1.00
R4590:Mmrn1 UTSW 6 60,937,797 (GRCm39) missense probably damaging 1.00
R4707:Mmrn1 UTSW 6 60,965,457 (GRCm39) missense probably benign 0.12
R4820:Mmrn1 UTSW 6 60,950,027 (GRCm39) missense probably benign 0.04
R4880:Mmrn1 UTSW 6 60,953,423 (GRCm39) missense probably benign 0.15
R5166:Mmrn1 UTSW 6 60,953,474 (GRCm39) missense probably benign 0.04
R5324:Mmrn1 UTSW 6 60,953,570 (GRCm39) missense probably damaging 1.00
R5887:Mmrn1 UTSW 6 60,964,058 (GRCm39) missense probably benign
R5917:Mmrn1 UTSW 6 60,950,134 (GRCm39) critical splice donor site probably null
R6108:Mmrn1 UTSW 6 60,952,960 (GRCm39) missense possibly damaging 0.83
R6539:Mmrn1 UTSW 6 60,964,168 (GRCm39) missense probably benign 0.01
R6996:Mmrn1 UTSW 6 60,954,367 (GRCm39) missense probably benign 0.04
R7064:Mmrn1 UTSW 6 60,965,524 (GRCm39) nonsense probably null
R7073:Mmrn1 UTSW 6 60,965,411 (GRCm39) missense probably damaging 1.00
R7213:Mmrn1 UTSW 6 60,921,527 (GRCm39) start gained probably benign
R7256:Mmrn1 UTSW 6 60,953,098 (GRCm39) missense probably damaging 0.98
R7324:Mmrn1 UTSW 6 60,921,917 (GRCm39) nonsense probably null
R7350:Mmrn1 UTSW 6 60,953,320 (GRCm39) nonsense probably null
R7388:Mmrn1 UTSW 6 60,953,236 (GRCm39) missense probably benign 0.43
R7652:Mmrn1 UTSW 6 60,954,490 (GRCm39) missense probably benign 0.14
R7664:Mmrn1 UTSW 6 60,953,689 (GRCm39) missense probably benign 0.44
R7810:Mmrn1 UTSW 6 60,953,309 (GRCm39) missense probably benign 0.18
R7832:Mmrn1 UTSW 6 60,964,044 (GRCm39) splice site probably null
R7979:Mmrn1 UTSW 6 60,952,961 (GRCm39) missense probably damaging 0.96
R8071:Mmrn1 UTSW 6 60,921,508 (GRCm39) start gained probably benign
R8130:Mmrn1 UTSW 6 60,937,707 (GRCm39) missense probably damaging 1.00
R8277:Mmrn1 UTSW 6 60,954,220 (GRCm39) missense probably benign 0.19
R8353:Mmrn1 UTSW 6 60,965,361 (GRCm39) missense probably damaging 1.00
R8453:Mmrn1 UTSW 6 60,965,361 (GRCm39) missense probably damaging 1.00
R8472:Mmrn1 UTSW 6 60,965,380 (GRCm39) missense probably damaging 1.00
R8758:Mmrn1 UTSW 6 60,964,193 (GRCm39) missense possibly damaging 0.54
R8803:Mmrn1 UTSW 6 60,965,271 (GRCm39) missense probably damaging 1.00
R8879:Mmrn1 UTSW 6 60,953,513 (GRCm39) missense probably damaging 0.99
R8907:Mmrn1 UTSW 6 60,953,077 (GRCm39) missense probably damaging 1.00
R8983:Mmrn1 UTSW 6 60,953,042 (GRCm39) missense probably benign 0.04
R9200:Mmrn1 UTSW 6 60,953,860 (GRCm39) missense probably damaging 1.00
R9287:Mmrn1 UTSW 6 60,952,939 (GRCm39) missense probably damaging 1.00
R9612:Mmrn1 UTSW 6 60,953,408 (GRCm39) missense probably damaging 0.96
R9674:Mmrn1 UTSW 6 60,948,072 (GRCm39) nonsense probably null
X0026:Mmrn1 UTSW 6 60,952,997 (GRCm39) missense probably benign 0.09
Z1176:Mmrn1 UTSW 6 60,922,018 (GRCm39) missense probably benign 0.37
Z1177:Mmrn1 UTSW 6 60,964,082 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CAAAGCATCTTACTGATCAAGGTAG -3'
(R):5'- CGAGACTACTAGACTTCAAGCTAAG -3'

Sequencing Primer
(F):5'- TTGCTCCCTCAGGAATTG -3'
(R):5'- GCATTAACTCACATGATTCTAAAAGC -3'
Posted On 2022-04-18