Incidental Mutation 'R9387:Lrrc27'
ID 710386
Institutional Source Beutler Lab
Gene Symbol Lrrc27
Ensembl Gene ENSMUSG00000015980
Gene Name leucine rich repeat containing 27
Synonyms 2310044E02Rik, 1700071K18Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.049) question?
Stock # R9387 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 138792904-138822895 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 138807837 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 315 (K315*)
Ref Sequence ENSEMBL: ENSMUSP00000016124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016124] [ENSMUST00000106104]
AlphaFold Q80YS5
Predicted Effect probably null
Transcript: ENSMUST00000016124
AA Change: K315*
SMART Domains Protein: ENSMUSP00000016124
Gene: ENSMUSG00000015980
AA Change: K315*

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
LRR_TYP 75 98 1.03e-2 SMART
LRR_TYP 99 122 3.69e-4 SMART
LRR 123 145 7.38e1 SMART
low complexity region 271 283 N/A INTRINSIC
coiled coil region 336 370 N/A INTRINSIC
coiled coil region 463 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106104
SMART Domains Protein: ENSMUSP00000101710
Gene: ENSMUSG00000015980

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
LRR_TYP 75 98 1.03e-2 SMART
LRR_TYP 99 122 3.69e-4 SMART
LRR 123 145 7.38e1 SMART
low complexity region 271 283 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,553,255 (GRCm39) D152G probably benign Het
Abcb1b G A 5: 8,875,614 (GRCm39) V596I probably benign Het
Acss3 A G 10: 106,959,255 (GRCm39) S64P probably damaging Het
Aggf1 T C 13: 95,507,461 (GRCm39) Y108C probably damaging Het
Arpc5l T C 2: 38,903,195 (GRCm39) V73A probably benign Het
Atp5f1d A G 10: 79,981,134 (GRCm39) D126G probably damaging Het
Carmil3 T A 14: 55,731,869 (GRCm39) L199* probably null Het
Cblb A G 16: 51,853,515 (GRCm39) R44G probably benign Het
Cdcp3 A G 7: 130,863,620 (GRCm39) I1208V unknown Het
Chaf1b T G 16: 93,689,629 (GRCm39) F225V probably benign Het
Creb3l2 A T 6: 37,356,751 (GRCm39) N105K probably damaging Het
Dagla A T 19: 10,248,465 (GRCm39) I65N probably damaging Het
Dclre1c T G 2: 3,425,342 (GRCm39) F30V probably damaging Het
Dicer1 A G 12: 104,695,499 (GRCm39) V144A possibly damaging Het
Dlg5 C T 14: 24,197,168 (GRCm39) G1593D probably damaging Het
Enpp3 A T 10: 24,711,990 (GRCm39) M1K probably null Het
Fmod C A 1: 133,968,514 (GRCm39) H185N probably benign Het
Gon4l A G 3: 88,802,260 (GRCm39) E957G probably benign Het
Hat1 A G 2: 71,264,512 (GRCm39) M310V possibly damaging Het
Klhl31 A T 9: 77,557,826 (GRCm39) T181S probably benign Het
Krt36 T A 11: 99,994,906 (GRCm39) E222V probably damaging Het
Mak16 T G 8: 31,650,794 (GRCm39) D232A probably damaging Het
Mepce A G 5: 137,783,322 (GRCm39) S335P possibly damaging Het
Mki67 T A 7: 135,302,378 (GRCm39) R885S probably damaging Het
Mmrn1 G A 6: 60,935,176 (GRCm39) W224* probably null Het
Mroh8 T A 2: 157,098,386 (GRCm39) Q254L possibly damaging Het
Mup18 A T 4: 61,590,854 (GRCm39) V101E probably damaging Het
Nbea T C 3: 55,898,460 (GRCm39) K1508R probably benign Het
Or5aq6 A T 2: 86,923,390 (GRCm39) M117K possibly damaging Het
Or5g9 A G 2: 85,551,806 (GRCm39) Y19C probably benign Het
Pcdh15 A T 10: 74,066,192 (GRCm39) I286F probably damaging Het
Pcdhb8 A T 18: 37,488,751 (GRCm39) Q143L probably benign Het
Pibf1 T C 14: 99,448,436 (GRCm39) S632P probably damaging Het
Senp6 A G 9: 79,999,646 (GRCm39) K100R probably damaging Het
Slc5a9 A G 4: 111,750,864 (GRCm39) S81P probably damaging Het
Sox8 T C 17: 25,786,338 (GRCm39) Q455R probably damaging Het
Stard13 A T 5: 151,113,483 (GRCm39) M26K probably benign Het
Sulf1 T A 1: 12,908,778 (GRCm39) M597K probably benign Het
Ugt2a3 T A 5: 87,484,832 (GRCm39) D64V probably benign Het
Unc80 T C 1: 66,589,097 (GRCm39) probably null Het
Vav3 A T 3: 109,565,291 (GRCm39) H729L probably benign Het
Vmn1r226 T A 17: 20,907,831 (GRCm39) L21Q probably damaging Het
Wdtc1 A G 4: 133,036,058 (GRCm39) probably null Het
Zfp984 A G 4: 147,840,002 (GRCm39) M283T probably benign Het
Zik1 A G 7: 10,224,623 (GRCm39) L158P probably damaging Het
Other mutations in Lrrc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Lrrc27 APN 7 138,807,827 (GRCm39) intron probably benign
IGL02095:Lrrc27 APN 7 138,810,169 (GRCm39) missense probably benign 0.04
IGL02489:Lrrc27 APN 7 138,805,977 (GRCm39) missense probably benign 0.01
IGL03080:Lrrc27 APN 7 138,810,153 (GRCm39) missense probably benign 0.03
R0372:Lrrc27 UTSW 7 138,806,103 (GRCm39) missense probably benign 0.17
R1466:Lrrc27 UTSW 7 138,810,224 (GRCm39) unclassified probably benign
R2401:Lrrc27 UTSW 7 138,803,529 (GRCm39) missense probably damaging 1.00
R2876:Lrrc27 UTSW 7 138,808,600 (GRCm39) intron probably benign
R3113:Lrrc27 UTSW 7 138,798,223 (GRCm39) missense probably damaging 1.00
R4214:Lrrc27 UTSW 7 138,803,609 (GRCm39) missense probably damaging 1.00
R4707:Lrrc27 UTSW 7 138,822,614 (GRCm39) missense probably benign 0.02
R4784:Lrrc27 UTSW 7 138,822,614 (GRCm39) missense probably benign 0.02
R5070:Lrrc27 UTSW 7 138,794,715 (GRCm39) missense probably damaging 0.99
R5855:Lrrc27 UTSW 7 138,798,251 (GRCm39) unclassified probably benign
R6408:Lrrc27 UTSW 7 138,798,184 (GRCm39) missense probably benign 0.14
R6993:Lrrc27 UTSW 7 138,822,540 (GRCm39) missense probably damaging 0.99
R7332:Lrrc27 UTSW 7 138,822,661 (GRCm39) missense probably damaging 1.00
R7350:Lrrc27 UTSW 7 138,806,022 (GRCm39) missense probably benign 0.01
R7460:Lrrc27 UTSW 7 138,803,574 (GRCm39) missense probably damaging 1.00
R7502:Lrrc27 UTSW 7 138,794,748 (GRCm39) missense probably benign
R8020:Lrrc27 UTSW 7 138,816,793 (GRCm39) missense probably damaging 1.00
R8071:Lrrc27 UTSW 7 138,816,902 (GRCm39) missense probably benign 0.01
R8518:Lrrc27 UTSW 7 138,808,690 (GRCm39) missense probably benign 0.01
R8728:Lrrc27 UTSW 7 138,822,555 (GRCm39) missense probably damaging 1.00
R8734:Lrrc27 UTSW 7 138,796,515 (GRCm39) unclassified probably benign
R9141:Lrrc27 UTSW 7 138,807,861 (GRCm39) missense probably benign 0.03
R9355:Lrrc27 UTSW 7 138,822,648 (GRCm39) missense probably damaging 0.98
R9627:Lrrc27 UTSW 7 138,808,582 (GRCm39) intron probably benign
R9742:Lrrc27 UTSW 7 138,806,229 (GRCm39) missense probably benign 0.39
R9779:Lrrc27 UTSW 7 138,816,886 (GRCm39) missense possibly damaging 0.95
R9800:Lrrc27 UTSW 7 138,807,913 (GRCm39) missense probably benign 0.16
RF018:Lrrc27 UTSW 7 138,806,016 (GRCm39) missense probably benign 0.03
X0065:Lrrc27 UTSW 7 138,810,162 (GRCm39) missense probably benign 0.00
X0065:Lrrc27 UTSW 7 138,810,161 (GRCm39) missense probably benign 0.00
Z1176:Lrrc27 UTSW 7 138,822,636 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTATTTCAATATGCAGTGGACCC -3'
(R):5'- AGGTCTCCCAATCCTGATGC -3'

Sequencing Primer
(F):5'- ACCAGGCCTGCTTTAAGC -3'
(R):5'- CCAATCCTGATGCTATCCCAG -3'
Posted On 2022-04-18