Incidental Mutation 'R9387:Lrrc27'
ID 710386
Institutional Source Beutler Lab
Gene Symbol Lrrc27
Ensembl Gene ENSMUSG00000015980
Gene Name leucine rich repeat containing 27
Synonyms 1700071K18Rik, 2310044E02Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock # R9387 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 139212988-139242979 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 139227921 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 315 (K315*)
Ref Sequence ENSEMBL: ENSMUSP00000016124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016124] [ENSMUST00000106104]
AlphaFold Q80YS5
Predicted Effect probably null
Transcript: ENSMUST00000016124
AA Change: K315*
SMART Domains Protein: ENSMUSP00000016124
Gene: ENSMUSG00000015980
AA Change: K315*

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
LRR_TYP 75 98 1.03e-2 SMART
LRR_TYP 99 122 3.69e-4 SMART
LRR 123 145 7.38e1 SMART
low complexity region 271 283 N/A INTRINSIC
coiled coil region 336 370 N/A INTRINSIC
coiled coil region 463 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106104
SMART Domains Protein: ENSMUSP00000101710
Gene: ENSMUSG00000015980

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
LRR_TYP 75 98 1.03e-2 SMART
LRR_TYP 99 122 3.69e-4 SMART
LRR 123 145 7.38e1 SMART
low complexity region 271 283 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,261,891 I1208V unknown Het
Abca17 T C 17: 24,334,281 D152G probably benign Het
Abcb1b G A 5: 8,825,614 V596I probably benign Het
Acss3 A G 10: 107,123,394 S64P probably damaging Het
Aggf1 T C 13: 95,370,953 Y108C probably damaging Het
Arpc5l T C 2: 39,013,183 V73A probably benign Het
Atp5d A G 10: 80,145,300 D126G probably damaging Het
Carmil3 T A 14: 55,494,412 L199* probably null Het
Cblb A G 16: 52,033,152 R44G probably benign Het
Chaf1b T G 16: 93,892,741 F225V probably benign Het
Creb3l2 A T 6: 37,379,816 N105K probably damaging Het
Dagla A T 19: 10,271,101 I65N probably damaging Het
Dclre1c T G 2: 3,424,305 F30V probably damaging Het
Dicer1 A G 12: 104,729,240 V144A possibly damaging Het
Dlg5 C T 14: 24,147,100 G1593D probably damaging Het
Enpp3 A T 10: 24,836,092 M1K probably null Het
Fmod C A 1: 134,040,776 H185N probably benign Het
Gon4l A G 3: 88,894,953 E957G probably benign Het
Hat1 A G 2: 71,434,168 M310V possibly damaging Het
Klhl31 A T 9: 77,650,544 T181S probably benign Het
Krt36 T A 11: 100,104,080 E222V probably damaging Het
Mak16 T G 8: 31,160,766 D232A probably damaging Het
Mepce A G 5: 137,785,060 S335P possibly damaging Het
Mki67 T A 7: 135,700,649 R885S probably damaging Het
Mmrn1 G A 6: 60,958,192 W224* probably null Het
Mroh8 T A 2: 157,256,466 Q254L possibly damaging Het
Mup18 A T 4: 61,672,617 V101E probably damaging Het
Nbea T C 3: 55,991,039 K1508R probably benign Het
Olfr1009 A G 2: 85,721,462 Y19C probably benign Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Pcdh15 A T 10: 74,230,360 I286F probably damaging Het
Pcdhb8 A T 18: 37,355,698 Q143L probably benign Het
Pibf1 T C 14: 99,211,000 S632P probably damaging Het
Senp6 A G 9: 80,092,364 K100R probably damaging Het
Slc5a9 A G 4: 111,893,667 S81P probably damaging Het
Sox8 T C 17: 25,567,364 Q455R probably damaging Het
Stard13 A T 5: 151,190,018 M26K probably benign Het
Sulf1 T A 1: 12,838,554 M597K probably benign Het
Ugt2a3 T A 5: 87,336,973 D64V probably benign Het
Unc80 T C 1: 66,549,938 probably null Het
Vav3 A T 3: 109,657,975 H729L probably benign Het
Vmn1r226 T A 17: 20,687,569 L21Q probably damaging Het
Wdtc1 A G 4: 133,308,747 probably null Het
Zfp984 A G 4: 147,755,545 M283T probably benign Het
Zik1 A G 7: 10,490,696 L158P probably damaging Het
Other mutations in Lrrc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Lrrc27 APN 7 139227911 intron probably benign
IGL02095:Lrrc27 APN 7 139230253 missense probably benign 0.04
IGL02489:Lrrc27 APN 7 139226061 missense probably benign 0.01
IGL03080:Lrrc27 APN 7 139230237 missense probably benign 0.03
R0372:Lrrc27 UTSW 7 139226187 missense probably benign 0.17
R1466:Lrrc27 UTSW 7 139230308 unclassified probably benign
R2401:Lrrc27 UTSW 7 139223613 missense probably damaging 1.00
R2876:Lrrc27 UTSW 7 139228684 intron probably benign
R3113:Lrrc27 UTSW 7 139218307 missense probably damaging 1.00
R4214:Lrrc27 UTSW 7 139223693 missense probably damaging 1.00
R4707:Lrrc27 UTSW 7 139242698 missense probably benign 0.02
R4784:Lrrc27 UTSW 7 139242698 missense probably benign 0.02
R5070:Lrrc27 UTSW 7 139214799 missense probably damaging 0.99
R5855:Lrrc27 UTSW 7 139218335 unclassified probably benign
R6408:Lrrc27 UTSW 7 139218268 missense probably benign 0.14
R6993:Lrrc27 UTSW 7 139242624 missense probably damaging 0.99
R7332:Lrrc27 UTSW 7 139242745 missense probably damaging 1.00
R7350:Lrrc27 UTSW 7 139226106 missense probably benign 0.01
R7460:Lrrc27 UTSW 7 139223658 missense probably damaging 1.00
R7502:Lrrc27 UTSW 7 139214832 missense probably benign
R8020:Lrrc27 UTSW 7 139236877 missense probably damaging 1.00
R8071:Lrrc27 UTSW 7 139236986 missense probably benign 0.01
R8518:Lrrc27 UTSW 7 139228774 missense probably benign 0.01
R8728:Lrrc27 UTSW 7 139242639 missense probably damaging 1.00
R8734:Lrrc27 UTSW 7 139216599 unclassified probably benign
R9141:Lrrc27 UTSW 7 139227945 missense probably benign 0.03
R9355:Lrrc27 UTSW 7 139242732 missense probably damaging 0.98
R9627:Lrrc27 UTSW 7 139228666 intron probably benign
R9742:Lrrc27 UTSW 7 139226313 missense probably benign 0.39
R9779:Lrrc27 UTSW 7 139236970 missense possibly damaging 0.95
R9800:Lrrc27 UTSW 7 139227997 missense probably benign 0.16
RF018:Lrrc27 UTSW 7 139226100 missense probably benign 0.03
X0065:Lrrc27 UTSW 7 139230245 missense probably benign 0.00
X0065:Lrrc27 UTSW 7 139230246 missense probably benign 0.00
Z1176:Lrrc27 UTSW 7 139242720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTATTTCAATATGCAGTGGACCC -3'
(R):5'- AGGTCTCCCAATCCTGATGC -3'

Sequencing Primer
(F):5'- ACCAGGCCTGCTTTAAGC -3'
(R):5'- CCAATCCTGATGCTATCCCAG -3'
Posted On 2022-04-18