Incidental Mutation 'R9387:Mak16'
ID 710387
Institutional Source Beutler Lab
Gene Symbol Mak16
Ensembl Gene ENSMUSG00000031578
Gene Name MAK16 homolog
Synonyms Rbm13, 2600016B03Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.970) question?
Stock # R9387 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 31649496-31658752 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 31650794 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 232 (D232A)
Ref Sequence ENSEMBL: ENSMUSP00000033983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033983] [ENSMUST00000098842] [ENSMUST00000209851] [ENSMUST00000209986] [ENSMUST00000210129]
AlphaFold Q8BGS0
Predicted Effect probably damaging
Transcript: ENSMUST00000033983
AA Change: D232A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033983
Gene: ENSMUSG00000031578
AA Change: D232A

DomainStartEndE-ValueType
Pfam:Ribosomal_L28e 6 119 5e-40 PFAM
Pfam:Mak16 138 235 4.7e-36 PFAM
low complexity region 242 256 N/A INTRINSIC
low complexity region 258 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098842
SMART Domains Protein: ENSMUSP00000096441
Gene: ENSMUSG00000031577

DomainStartEndE-ValueType
Pfam:DUF2454 208 397 7.1e-17 PFAM
low complexity region 426 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209851
Predicted Effect probably benign
Transcript: ENSMUST00000209986
Predicted Effect probably benign
Transcript: ENSMUST00000210129
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,553,255 (GRCm39) D152G probably benign Het
Abcb1b G A 5: 8,875,614 (GRCm39) V596I probably benign Het
Acss3 A G 10: 106,959,255 (GRCm39) S64P probably damaging Het
Aggf1 T C 13: 95,507,461 (GRCm39) Y108C probably damaging Het
Arpc5l T C 2: 38,903,195 (GRCm39) V73A probably benign Het
Atp5f1d A G 10: 79,981,134 (GRCm39) D126G probably damaging Het
Carmil3 T A 14: 55,731,869 (GRCm39) L199* probably null Het
Cblb A G 16: 51,853,515 (GRCm39) R44G probably benign Het
Cdcp3 A G 7: 130,863,620 (GRCm39) I1208V unknown Het
Chaf1b T G 16: 93,689,629 (GRCm39) F225V probably benign Het
Creb3l2 A T 6: 37,356,751 (GRCm39) N105K probably damaging Het
Dagla A T 19: 10,248,465 (GRCm39) I65N probably damaging Het
Dclre1c T G 2: 3,425,342 (GRCm39) F30V probably damaging Het
Dicer1 A G 12: 104,695,499 (GRCm39) V144A possibly damaging Het
Dlg5 C T 14: 24,197,168 (GRCm39) G1593D probably damaging Het
Enpp3 A T 10: 24,711,990 (GRCm39) M1K probably null Het
Fmod C A 1: 133,968,514 (GRCm39) H185N probably benign Het
Gon4l A G 3: 88,802,260 (GRCm39) E957G probably benign Het
Hat1 A G 2: 71,264,512 (GRCm39) M310V possibly damaging Het
Klhl31 A T 9: 77,557,826 (GRCm39) T181S probably benign Het
Krt36 T A 11: 99,994,906 (GRCm39) E222V probably damaging Het
Lrrc27 A T 7: 138,807,837 (GRCm39) K315* probably null Het
Mepce A G 5: 137,783,322 (GRCm39) S335P possibly damaging Het
Mki67 T A 7: 135,302,378 (GRCm39) R885S probably damaging Het
Mmrn1 G A 6: 60,935,176 (GRCm39) W224* probably null Het
Mroh8 T A 2: 157,098,386 (GRCm39) Q254L possibly damaging Het
Mup18 A T 4: 61,590,854 (GRCm39) V101E probably damaging Het
Nbea T C 3: 55,898,460 (GRCm39) K1508R probably benign Het
Or5aq6 A T 2: 86,923,390 (GRCm39) M117K possibly damaging Het
Or5g9 A G 2: 85,551,806 (GRCm39) Y19C probably benign Het
Pcdh15 A T 10: 74,066,192 (GRCm39) I286F probably damaging Het
Pcdhb8 A T 18: 37,488,751 (GRCm39) Q143L probably benign Het
Pibf1 T C 14: 99,448,436 (GRCm39) S632P probably damaging Het
Senp6 A G 9: 79,999,646 (GRCm39) K100R probably damaging Het
Slc5a9 A G 4: 111,750,864 (GRCm39) S81P probably damaging Het
Sox8 T C 17: 25,786,338 (GRCm39) Q455R probably damaging Het
Stard13 A T 5: 151,113,483 (GRCm39) M26K probably benign Het
Sulf1 T A 1: 12,908,778 (GRCm39) M597K probably benign Het
Ugt2a3 T A 5: 87,484,832 (GRCm39) D64V probably benign Het
Unc80 T C 1: 66,589,097 (GRCm39) probably null Het
Vav3 A T 3: 109,565,291 (GRCm39) H729L probably benign Het
Vmn1r226 T A 17: 20,907,831 (GRCm39) L21Q probably damaging Het
Wdtc1 A G 4: 133,036,058 (GRCm39) probably null Het
Zfp984 A G 4: 147,840,002 (GRCm39) M283T probably benign Het
Zik1 A G 7: 10,224,623 (GRCm39) L158P probably damaging Het
Other mutations in Mak16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Mak16 APN 8 31,656,778 (GRCm39) missense probably benign
IGL02071:Mak16 APN 8 31,650,557 (GRCm39) missense probably benign 0.00
IGL02457:Mak16 APN 8 31,654,753 (GRCm39) missense possibly damaging 0.83
IGL02486:Mak16 APN 8 31,650,614 (GRCm39) intron probably benign
FR4342:Mak16 UTSW 8 31,651,777 (GRCm39) missense probably benign 0.00
R4527:Mak16 UTSW 8 31,656,205 (GRCm39) nonsense probably null
R4807:Mak16 UTSW 8 31,656,161 (GRCm39) missense probably benign 0.25
R7178:Mak16 UTSW 8 31,656,602 (GRCm39) missense probably benign 0.06
R7315:Mak16 UTSW 8 31,654,766 (GRCm39) nonsense probably null
R7366:Mak16 UTSW 8 31,656,127 (GRCm39) missense possibly damaging 0.88
R8311:Mak16 UTSW 8 31,658,697 (GRCm39) missense probably damaging 1.00
R9690:Mak16 UTSW 8 31,650,798 (GRCm39) missense probably damaging 1.00
Z1088:Mak16 UTSW 8 31,656,123 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCAGACCAGGGAAAGTGC -3'
(R):5'- TGTTGACTTTTACATGTGTCCCT -3'

Sequencing Primer
(F):5'- CAGGGAAAGTGCAAGCCTTCTC -3'
(R):5'- TATGTGTGAACCTTGAGAGTAATAGG -3'
Posted On 2022-04-18