Mutagenetix > Incidental Mutation

Incidental Mutation 'R9387:Enpp3'

710390

Institutional Source

Beutler Lab

Gene Symbol

Enpp3

Ensembl Gene

ENSMUSG00000019989

Gene Name

ectonucleotide pyrophosphatase/phosphodiesterase 3

Synonyms

CD203c

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.236) question?

Stock #

R9387 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24772406-24842823 bp(-) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

A to T at 24836092 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1 (M1K)

Ref Sequence

ENSEMBL: ENSMUSP00000020169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020169] [ENSMUST00000217903] [ENSMUST00000218044] [ENSMUST00000219342] [ENSMUST00000219968] [ENSMUST00000220209]

AlphaFold

Q6DYE8

Predicted Effect

probably null
Transcript: ENSMUST00000020169
AA Change: M1K

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: M1K

Domain	Start	End	E-Value	Type
transmembrane domain	23	45	N/A	INTRINSIC
SO	50	93	1.99e-13	SMART
SO	94	137	7.66e-15	SMART
Pfam:Phosphodiest	161	485	1.7e-87	PFAM
Blast:Endonuclease_NS	543	599	9e-15	BLAST
Endonuclease_NS	626	847	5.41e-16	SMART
NUC	627	856	1.54e-92	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000217903

Predicted Effect

probably null
Transcript: ENSMUST00000218044
AA Change: M1K

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000219342

Predicted Effect

probably benign
Transcript: ENSMUST00000219968

Predicted Effect

probably null
Transcript: ENSMUST00000220209
AA Change: M1K

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.6%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	G	7: 131,261,891	I1208V	unknown	Het
Abca17	T	C	17: 24,334,281	D152G	probably benign	Het
Abcb1b	G	A	5: 8,825,614	V596I	probably benign	Het
Acss3	A	G	10: 107,123,394	S64P	probably damaging	Het
Aggf1	T	C	13: 95,370,953	Y108C	probably damaging	Het
Arpc5l	T	C	2: 39,013,183	V73A	probably benign	Het
Atp5d	A	G	10: 80,145,300	D126G	probably damaging	Het
Carmil3	T	A	14: 55,494,412	L199*	probably null	Het
Cblb	A	G	16: 52,033,152	R44G	probably benign	Het
Chaf1b	T	G	16: 93,892,741	F225V	probably benign	Het
Creb3l2	A	T	6: 37,379,816	N105K	probably damaging	Het
Dagla	A	T	19: 10,271,101	I65N	probably damaging	Het
Dclre1c	T	G	2: 3,424,305	F30V	probably damaging	Het
Dicer1	A	G	12: 104,729,240	V144A	possibly damaging	Het
Dlg5	C	T	14: 24,147,100	G1593D	probably damaging	Het
Fmod	C	A	1: 134,040,776	H185N	probably benign	Het
Gon4l	A	G	3: 88,894,953	E957G	probably benign	Het
Hat1	A	G	2: 71,434,168	M310V	possibly damaging	Het
Klhl31	A	T	9: 77,650,544	T181S	probably benign	Het
Krt36	T	A	11: 100,104,080	E222V	probably damaging	Het
Lrrc27	A	T	7: 139,227,921	K315*	probably null	Het
Mak16	T	G	8: 31,160,766	D232A	probably damaging	Het
Mepce	A	G	5: 137,785,060	S335P	possibly damaging	Het
Mki67	T	A	7: 135,700,649	R885S	probably damaging	Het
Mmrn1	G	A	6: 60,958,192	W224*	probably null	Het
Mroh8	T	A	2: 157,256,466	Q254L	possibly damaging	Het
Mup18	A	T	4: 61,672,617	V101E	probably damaging	Het
Nbea	T	C	3: 55,991,039	K1508R	probably benign	Het
Olfr1009	A	G	2: 85,721,462	Y19C	probably benign	Het
Olfr1109	A	T	2: 87,093,046	M117K	possibly damaging	Het
Pcdh15	A	T	10: 74,230,360	I286F	probably damaging	Het
Pcdhb8	A	T	18: 37,355,698	Q143L	probably benign	Het
Pibf1	T	C	14: 99,211,000	S632P	probably damaging	Het
Senp6	A	G	9: 80,092,364	K100R	probably damaging	Het
Slc5a9	A	G	4: 111,893,667	S81P	probably damaging	Het
Sox8	T	C	17: 25,567,364	Q455R	probably damaging	Het
Stard13	A	T	5: 151,190,018	M26K	probably benign	Het
Sulf1	T	A	1: 12,838,554	M597K	probably benign	Het
Ugt2a3	T	A	5: 87,336,973	D64V	probably benign	Het
Unc80	T	C	1: 66,549,938		probably null	Het
Vav3	A	T	3: 109,657,975	H729L	probably benign	Het
Vmn1r226	T	A	17: 20,687,569	L21Q	probably damaging	Het
Wdtc1	A	G	4: 133,308,747		probably null	Het
Zfp984	A	G	4: 147,755,545	M283T	probably benign	Het
Zik1	A	G	7: 10,490,696	L158P	probably damaging	Het

Other mutations in Enpp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Enpp3	APN	10	24787772	missense	probably benign	0.00
IGL00778:Enpp3	APN	10	24798262	missense	probably damaging	1.00
IGL01147:Enpp3	APN	10	24774907	missense	probably damaging	1.00
IGL01343:Enpp3	APN	10	24805922	nonsense	probably null
IGL01642:Enpp3	APN	10	24798269	missense	probably damaging	1.00
IGL01814:Enpp3	APN	10	24792025	missense	possibly damaging	0.68
IGL02083:Enpp3	APN	10	24776794	missense	probably damaging	1.00
IGL02152:Enpp3	APN	10	24774002	missense	probably damaging	1.00
IGL02186:Enpp3	APN	10	24791983	splice site	probably benign
IGL02517:Enpp3	APN	10	24809848	splice site	probably benign
IGL02956:Enpp3	APN	10	24774943	splice site	probably benign
R0017:Enpp3	UTSW	10	24799153	splice site	probably null
R0042:Enpp3	UTSW	10	24774824	missense	probably damaging	1.00
R0110:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0218:Enpp3	UTSW	10	24776869	missense	possibly damaging	0.80
R0403:Enpp3	UTSW	10	24804436	missense	probably damaging	1.00
R0433:Enpp3	UTSW	10	24820597	missense	probably benign	0.00
R0450:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0510:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0826:Enpp3	UTSW	10	24795716	missense	probably damaging	1.00
R1245:Enpp3	UTSW	10	24784953	splice site	probably benign
R1261:Enpp3	UTSW	10	24774934	missense	probably damaging	0.97
R1633:Enpp3	UTSW	10	24795782	missense	probably damaging	1.00
R1903:Enpp3	UTSW	10	24778789	missense	probably damaging	1.00
R1913:Enpp3	UTSW	10	24776771	nonsense	probably null
R1966:Enpp3	UTSW	10	24807491	missense	probably damaging	0.99
R2157:Enpp3	UTSW	10	24776878	missense	probably damaging	1.00
R2179:Enpp3	UTSW	10	24805895	missense	probably benign	0.00
R2380:Enpp3	UTSW	10	24776872	missense	probably benign
R2410:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R3794:Enpp3	UTSW	10	24831732	splice site	probably null
R3896:Enpp3	UTSW	10	24777949	missense	possibly damaging	0.79
R4334:Enpp3	UTSW	10	24793589	missense	probably damaging	1.00
R4569:Enpp3	UTSW	10	24776882	missense	probably damaging	1.00
R4766:Enpp3	UTSW	10	24773927	missense	probably damaging	1.00
R4951:Enpp3	UTSW	10	24798277	missense	probably damaging	1.00
R4998:Enpp3	UTSW	10	24807538	missense	probably benign	0.01
R5045:Enpp3	UTSW	10	24776767	missense	probably damaging	1.00
R5276:Enpp3	UTSW	10	24809916	missense	probably damaging	1.00
R5331:Enpp3	UTSW	10	24808160	missense	probably damaging	1.00
R5569:Enpp3	UTSW	10	24778821	missense	probably damaging	0.98
R5975:Enpp3	UTSW	10	24774842	missense	probably benign	0.37
R6117:Enpp3	UTSW	10	24787852	missense	probably damaging	1.00
R6419:Enpp3	UTSW	10	24808191	missense	probably damaging	1.00
R6677:Enpp3	UTSW	10	24777957	missense	possibly damaging	0.88
R6735:Enpp3	UTSW	10	24807453	missense	probably damaging	1.00
R6833:Enpp3	UTSW	10	24809870	missense	probably damaging	1.00
R6999:Enpp3	UTSW	10	24808166	missense	probably damaging	1.00
R7022:Enpp3	UTSW	10	24826195	missense	probably damaging	0.99
R7173:Enpp3	UTSW	10	24774047	missense	probably damaging	1.00
R7224:Enpp3	UTSW	10	24776884	missense	possibly damaging	0.63
R7227:Enpp3	UTSW	10	24817844	missense	unknown
R7487:Enpp3	UTSW	10	24805923	missense	probably benign	0.02
R7529:Enpp3	UTSW	10	24798174	missense	probably damaging	0.97
R7583:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R7692:Enpp3	UTSW	10	24784841	nonsense	probably null
R7962:Enpp3	UTSW	10	24784854	missense	probably damaging	1.00
R7965:Enpp3	UTSW	10	24778819	missense	possibly damaging	0.90
R8153:Enpp3	UTSW	10	24809879	missense	probably damaging	1.00
R8262:Enpp3	UTSW	10	24777926	missense	probably damaging	1.00
R8305:Enpp3	UTSW	10	24824929	critical splice acceptor site	probably null
R8393:Enpp3	UTSW	10	24826241	missense	probably damaging	1.00
R8776:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8776-TAIL:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8962:Enpp3	UTSW	10	24820615	missense	probably benign	0.12
R9047:Enpp3	UTSW	10	24798274	missense	possibly damaging	0.83
R9093:Enpp3	UTSW	10	24795804	missense	probably benign	0.00
R9117:Enpp3	UTSW	10	24826180	missense	possibly damaging	0.67
R9194:Enpp3	UTSW	10	24799194	missense	possibly damaging	0.90
R9224:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R9244:Enpp3	UTSW	10	24778791	missense	probably damaging	1.00
R9644:Enpp3	UTSW	10	24809903	missense	probably damaging	0.98
R9658:Enpp3	UTSW	10	24773904	makesense	probably null
X0026:Enpp3	UTSW	10	24826242	missense	probably damaging	1.00
Z1176:Enpp3	UTSW	10	24787793	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTGACTTAATAGCGACACAAGCAAG -3'
(R):5'- ACTGCTGTCCACAATGTCCG -3'

Sequencing Primer
(F):5'- CGACACAAGCAAGCCTAAGTGG -3'
(R):5'- GCAACGCTGTTTGTTAACAAGGC -3'

Posted On

2022-04-18