Incidental Mutation 'R9387:Enpp3'
ID 710390
Institutional Source Beutler Lab
Gene Symbol Enpp3
Ensembl Gene ENSMUSG00000019989
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 3
Synonyms CD203c
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R9387 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 24649712-24712093 bp(-) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) A to T at 24711990 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000020169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020169] [ENSMUST00000217903] [ENSMUST00000218044] [ENSMUST00000219342] [ENSMUST00000219968] [ENSMUST00000220209]
AlphaFold Q6DYE8
Predicted Effect probably null
Transcript: ENSMUST00000020169
AA Change: M1K

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: M1K

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
SO 50 93 1.99e-13 SMART
SO 94 137 7.66e-15 SMART
Pfam:Phosphodiest 161 485 1.7e-87 PFAM
Blast:Endonuclease_NS 543 599 9e-15 BLAST
Endonuclease_NS 626 847 5.41e-16 SMART
NUC 627 856 1.54e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217903
Predicted Effect probably null
Transcript: ENSMUST00000218044
AA Change: M1K

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000219342
Predicted Effect probably benign
Transcript: ENSMUST00000219968
Predicted Effect probably null
Transcript: ENSMUST00000220209
AA Change: M1K
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,553,255 (GRCm39) D152G probably benign Het
Abcb1b G A 5: 8,875,614 (GRCm39) V596I probably benign Het
Acss3 A G 10: 106,959,255 (GRCm39) S64P probably damaging Het
Aggf1 T C 13: 95,507,461 (GRCm39) Y108C probably damaging Het
Arpc5l T C 2: 38,903,195 (GRCm39) V73A probably benign Het
Atp5f1d A G 10: 79,981,134 (GRCm39) D126G probably damaging Het
Carmil3 T A 14: 55,731,869 (GRCm39) L199* probably null Het
Cblb A G 16: 51,853,515 (GRCm39) R44G probably benign Het
Cdcp3 A G 7: 130,863,620 (GRCm39) I1208V unknown Het
Chaf1b T G 16: 93,689,629 (GRCm39) F225V probably benign Het
Creb3l2 A T 6: 37,356,751 (GRCm39) N105K probably damaging Het
Dagla A T 19: 10,248,465 (GRCm39) I65N probably damaging Het
Dclre1c T G 2: 3,425,342 (GRCm39) F30V probably damaging Het
Dicer1 A G 12: 104,695,499 (GRCm39) V144A possibly damaging Het
Dlg5 C T 14: 24,197,168 (GRCm39) G1593D probably damaging Het
Fmod C A 1: 133,968,514 (GRCm39) H185N probably benign Het
Gon4l A G 3: 88,802,260 (GRCm39) E957G probably benign Het
Hat1 A G 2: 71,264,512 (GRCm39) M310V possibly damaging Het
Klhl31 A T 9: 77,557,826 (GRCm39) T181S probably benign Het
Krt36 T A 11: 99,994,906 (GRCm39) E222V probably damaging Het
Lrrc27 A T 7: 138,807,837 (GRCm39) K315* probably null Het
Mak16 T G 8: 31,650,794 (GRCm39) D232A probably damaging Het
Mepce A G 5: 137,783,322 (GRCm39) S335P possibly damaging Het
Mki67 T A 7: 135,302,378 (GRCm39) R885S probably damaging Het
Mmrn1 G A 6: 60,935,176 (GRCm39) W224* probably null Het
Mroh8 T A 2: 157,098,386 (GRCm39) Q254L possibly damaging Het
Mup18 A T 4: 61,590,854 (GRCm39) V101E probably damaging Het
Nbea T C 3: 55,898,460 (GRCm39) K1508R probably benign Het
Or5aq6 A T 2: 86,923,390 (GRCm39) M117K possibly damaging Het
Or5g9 A G 2: 85,551,806 (GRCm39) Y19C probably benign Het
Pcdh15 A T 10: 74,066,192 (GRCm39) I286F probably damaging Het
Pcdhb8 A T 18: 37,488,751 (GRCm39) Q143L probably benign Het
Pibf1 T C 14: 99,448,436 (GRCm39) S632P probably damaging Het
Senp6 A G 9: 79,999,646 (GRCm39) K100R probably damaging Het
Slc5a9 A G 4: 111,750,864 (GRCm39) S81P probably damaging Het
Sox8 T C 17: 25,786,338 (GRCm39) Q455R probably damaging Het
Stard13 A T 5: 151,113,483 (GRCm39) M26K probably benign Het
Sulf1 T A 1: 12,908,778 (GRCm39) M597K probably benign Het
Ugt2a3 T A 5: 87,484,832 (GRCm39) D64V probably benign Het
Unc80 T C 1: 66,589,097 (GRCm39) probably null Het
Vav3 A T 3: 109,565,291 (GRCm39) H729L probably benign Het
Vmn1r226 T A 17: 20,907,831 (GRCm39) L21Q probably damaging Het
Wdtc1 A G 4: 133,036,058 (GRCm39) probably null Het
Zfp984 A G 4: 147,840,002 (GRCm39) M283T probably benign Het
Zik1 A G 7: 10,224,623 (GRCm39) L158P probably damaging Het
Other mutations in Enpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Enpp3 APN 10 24,663,670 (GRCm39) missense probably benign 0.00
IGL00778:Enpp3 APN 10 24,674,160 (GRCm39) missense probably damaging 1.00
IGL01147:Enpp3 APN 10 24,650,805 (GRCm39) missense probably damaging 1.00
IGL01343:Enpp3 APN 10 24,681,820 (GRCm39) nonsense probably null
IGL01642:Enpp3 APN 10 24,674,167 (GRCm39) missense probably damaging 1.00
IGL01814:Enpp3 APN 10 24,667,923 (GRCm39) missense possibly damaging 0.68
IGL02083:Enpp3 APN 10 24,652,692 (GRCm39) missense probably damaging 1.00
IGL02152:Enpp3 APN 10 24,649,900 (GRCm39) missense probably damaging 1.00
IGL02186:Enpp3 APN 10 24,667,881 (GRCm39) splice site probably benign
IGL02517:Enpp3 APN 10 24,685,746 (GRCm39) splice site probably benign
IGL02956:Enpp3 APN 10 24,650,841 (GRCm39) splice site probably benign
R0017:Enpp3 UTSW 10 24,675,051 (GRCm39) splice site probably null
R0042:Enpp3 UTSW 10 24,650,722 (GRCm39) missense probably damaging 1.00
R0110:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0218:Enpp3 UTSW 10 24,652,767 (GRCm39) missense possibly damaging 0.80
R0403:Enpp3 UTSW 10 24,680,334 (GRCm39) missense probably damaging 1.00
R0433:Enpp3 UTSW 10 24,696,495 (GRCm39) missense probably benign 0.00
R0450:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0510:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0826:Enpp3 UTSW 10 24,671,614 (GRCm39) missense probably damaging 1.00
R1245:Enpp3 UTSW 10 24,660,851 (GRCm39) splice site probably benign
R1261:Enpp3 UTSW 10 24,650,832 (GRCm39) missense probably damaging 0.97
R1633:Enpp3 UTSW 10 24,671,680 (GRCm39) missense probably damaging 1.00
R1903:Enpp3 UTSW 10 24,654,687 (GRCm39) missense probably damaging 1.00
R1913:Enpp3 UTSW 10 24,652,669 (GRCm39) nonsense probably null
R1966:Enpp3 UTSW 10 24,683,389 (GRCm39) missense probably damaging 0.99
R2157:Enpp3 UTSW 10 24,652,776 (GRCm39) missense probably damaging 1.00
R2179:Enpp3 UTSW 10 24,681,793 (GRCm39) missense probably benign 0.00
R2380:Enpp3 UTSW 10 24,652,770 (GRCm39) missense probably benign
R2410:Enpp3 UTSW 10 24,650,716 (GRCm39) missense probably benign 0.00
R3794:Enpp3 UTSW 10 24,707,630 (GRCm39) splice site probably null
R3896:Enpp3 UTSW 10 24,653,847 (GRCm39) missense possibly damaging 0.79
R4334:Enpp3 UTSW 10 24,669,487 (GRCm39) missense probably damaging 1.00
R4569:Enpp3 UTSW 10 24,652,780 (GRCm39) missense probably damaging 1.00
R4766:Enpp3 UTSW 10 24,649,825 (GRCm39) missense probably damaging 1.00
R4951:Enpp3 UTSW 10 24,674,175 (GRCm39) missense probably damaging 1.00
R4998:Enpp3 UTSW 10 24,683,436 (GRCm39) missense probably benign 0.01
R5045:Enpp3 UTSW 10 24,652,665 (GRCm39) missense probably damaging 1.00
R5276:Enpp3 UTSW 10 24,685,814 (GRCm39) missense probably damaging 1.00
R5331:Enpp3 UTSW 10 24,684,058 (GRCm39) missense probably damaging 1.00
R5569:Enpp3 UTSW 10 24,654,719 (GRCm39) missense probably damaging 0.98
R5975:Enpp3 UTSW 10 24,650,740 (GRCm39) missense probably benign 0.37
R6117:Enpp3 UTSW 10 24,663,750 (GRCm39) missense probably damaging 1.00
R6419:Enpp3 UTSW 10 24,684,089 (GRCm39) missense probably damaging 1.00
R6677:Enpp3 UTSW 10 24,653,855 (GRCm39) missense possibly damaging 0.88
R6735:Enpp3 UTSW 10 24,683,351 (GRCm39) missense probably damaging 1.00
R6833:Enpp3 UTSW 10 24,685,768 (GRCm39) missense probably damaging 1.00
R6999:Enpp3 UTSW 10 24,684,064 (GRCm39) missense probably damaging 1.00
R7022:Enpp3 UTSW 10 24,702,093 (GRCm39) missense probably damaging 0.99
R7173:Enpp3 UTSW 10 24,649,945 (GRCm39) missense probably damaging 1.00
R7224:Enpp3 UTSW 10 24,652,782 (GRCm39) missense possibly damaging 0.63
R7227:Enpp3 UTSW 10 24,693,742 (GRCm39) missense unknown
R7487:Enpp3 UTSW 10 24,681,821 (GRCm39) missense probably benign 0.02
R7529:Enpp3 UTSW 10 24,674,072 (GRCm39) missense probably damaging 0.97
R7583:Enpp3 UTSW 10 24,711,990 (GRCm39) start codon destroyed probably null 0.83
R7692:Enpp3 UTSW 10 24,660,739 (GRCm39) nonsense probably null
R7962:Enpp3 UTSW 10 24,660,752 (GRCm39) missense probably damaging 1.00
R7965:Enpp3 UTSW 10 24,654,717 (GRCm39) missense possibly damaging 0.90
R8153:Enpp3 UTSW 10 24,685,777 (GRCm39) missense probably damaging 1.00
R8262:Enpp3 UTSW 10 24,653,824 (GRCm39) missense probably damaging 1.00
R8305:Enpp3 UTSW 10 24,700,827 (GRCm39) critical splice acceptor site probably null
R8393:Enpp3 UTSW 10 24,702,139 (GRCm39) missense probably damaging 1.00
R8776:Enpp3 UTSW 10 24,650,733 (GRCm39) missense probably damaging 1.00
R8776-TAIL:Enpp3 UTSW 10 24,650,733 (GRCm39) missense probably damaging 1.00
R8962:Enpp3 UTSW 10 24,696,513 (GRCm39) missense probably benign 0.12
R9047:Enpp3 UTSW 10 24,674,172 (GRCm39) missense possibly damaging 0.83
R9093:Enpp3 UTSW 10 24,671,702 (GRCm39) missense probably benign 0.00
R9117:Enpp3 UTSW 10 24,702,078 (GRCm39) missense possibly damaging 0.67
R9194:Enpp3 UTSW 10 24,675,092 (GRCm39) missense possibly damaging 0.90
R9224:Enpp3 UTSW 10 24,650,716 (GRCm39) missense probably benign 0.00
R9244:Enpp3 UTSW 10 24,654,689 (GRCm39) missense probably damaging 1.00
R9644:Enpp3 UTSW 10 24,685,801 (GRCm39) missense probably damaging 0.98
R9658:Enpp3 UTSW 10 24,649,802 (GRCm39) makesense probably null
X0026:Enpp3 UTSW 10 24,702,140 (GRCm39) missense probably damaging 1.00
Z1176:Enpp3 UTSW 10 24,663,691 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGACTTAATAGCGACACAAGCAAG -3'
(R):5'- ACTGCTGTCCACAATGTCCG -3'

Sequencing Primer
(F):5'- CGACACAAGCAAGCCTAAGTGG -3'
(R):5'- GCAACGCTGTTTGTTAACAAGGC -3'
Posted On 2022-04-18