Incidental Mutation 'R9388:Myh7b'
ID 710415
Institutional Source Beutler Lab
Gene Symbol Myh7b
Ensembl Gene ENSMUSG00000074652
Gene Name myosin, heavy chain 7B, cardiac muscle, beta
Synonyms Myh14
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9388 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 155611212-155634307 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 155631063 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 1415 (N1415Y)
Ref Sequence ENSEMBL: ENSMUSP00000090672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041059] [ENSMUST00000092995] [ENSMUST00000103140]
AlphaFold A2AQP0
Predicted Effect probably benign
Transcript: ENSMUST00000041059
SMART Domains Protein: ENSMUSP00000037574
Gene: ENSMUSG00000038324

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 38 53 N/A INTRINSIC
Pfam:DUF3689 407 714 5.2e-135 PFAM
low complexity region 724 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092995
AA Change: N1415Y

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: N1415Y

DomainStartEndE-ValueType
Pfam:Myosin_N 32 72 4.7e-14 PFAM
MYSc 78 786 N/A SMART
IQ 787 809 2.6e0 SMART
Pfam:Myosin_tail_1 850 1931 5.5e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103140
SMART Domains Protein: ENSMUSP00000099429
Gene: ENSMUSG00000038324

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 38 53 N/A INTRINSIC
Pfam:DUF3689 399 710 1.1e-138 PFAM
low complexity region 716 727 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T A 5: 113,190,848 T433S probably benign Het
Abca14 A G 7: 120,283,038 D1141G probably benign Het
Abca17 A G 17: 24,264,299 S1728P unknown Het
Adam29 A C 8: 55,872,250 C390G probably damaging Het
Angptl4 G A 17: 33,777,184 R273* probably null Het
Arfgef3 T C 10: 18,630,129 N929S probably benign Het
Baiap3 A G 17: 25,247,135 probably null Het
Btla T C 16: 45,239,091 S53P probably damaging Het
Cand1 A G 10: 119,211,308 F759S possibly damaging Het
Cbll1 T C 12: 31,491,568 T104A probably benign Het
Chd7 A G 4: 8,865,756 M2688V possibly damaging Het
Cnot3 C A 7: 3,658,368 H625Q possibly damaging Het
Dbn1 T C 13: 55,476,275 I381V probably benign Het
Dennd2d T A 3: 106,488,599 N135K possibly damaging Het
Dnah7c T C 1: 46,740,726 I3196T probably damaging Het
Dock2 C A 11: 34,262,460 R1227L possibly damaging Het
Esr1 A G 10: 4,969,179 E423G probably benign Het
Ganab A G 19: 8,914,938 Q826R probably damaging Het
Herc4 T A 10: 63,307,743 M684K probably benign Het
Hipk2 A G 6: 38,731,021 L613P probably damaging Het
Hpf1 A T 8: 60,900,148 I188L probably benign Het
Ifnar1 C T 16: 91,495,479 P207L probably benign Het
Il4 C T 11: 53,614,010 R76H probably damaging Het
Kif1a C A 1: 93,072,307 probably null Het
Kng1 A T 16: 23,079,638 Y596F possibly damaging Het
Lrrc8d T A 5: 105,813,996 H757Q probably damaging Het
Med24 A T 11: 98,710,067 I600N possibly damaging Het
Mmp10 G A 9: 7,504,169 W203* probably null Het
Mnt C T 11: 74,836,624 A112V probably benign Het
Nipal1 T A 5: 72,668,214 *417R probably null Het
Nlrp4c C T 7: 6,066,875 Q592* probably null Het
Obscn T C 11: 59,052,663 E4220G probably damaging Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr129 C T 17: 38,055,257 C103Y probably damaging Het
Olfr1369-ps1 T C 13: 21,116,604 L304P probably damaging Het
Olfr537-ps1 G T 7: 140,539,015 C166F unknown Het
Pcdhb20 A T 18: 37,505,800 I460F probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Primpol G A 8: 46,581,570 T441I possibly damaging Het
Prpmp5 T C 6: 132,312,474 Q129R unknown Het
Ptprc A G 1: 138,083,642 V583A possibly damaging Het
Rfx6 T C 10: 51,678,021 V71A possibly damaging Het
Rgsl1 T C 1: 153,817,609 I574V probably benign Het
Rims3 A G 4: 120,891,355 I258V possibly damaging Het
Sec16b T C 1: 157,560,823 Y776H probably benign Het
Skint6 C T 4: 113,192,641 D276N possibly damaging Het
Slc45a1 T C 4: 150,642,610 D184G probably damaging Het
St6galnac4 A T 2: 32,589,613 S61C probably damaging Het
Stab1 C T 14: 31,154,355 V926M probably damaging Het
Stat1 A T 1: 52,153,878 K642N possibly damaging Het
Tmprss3 A G 17: 31,191,067 F191S probably damaging Het
Ube2o T C 11: 116,539,384 D1176G possibly damaging Het
Usp17ld G T 7: 103,250,938 N262K probably benign Het
Xpnpep1 T C 19: 53,004,802 K365E probably damaging Het
Other mutations in Myh7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Myh7b APN 2 155630292 missense probably damaging 0.99
IGL01604:Myh7b APN 2 155632407 missense probably damaging 0.96
IGL02179:Myh7b APN 2 155614491 missense probably benign 0.02
IGL02729:Myh7b APN 2 155625689 missense probably damaging 1.00
IGL02804:Myh7b APN 2 155625723 missense probably damaging 1.00
IGL02851:Myh7b APN 2 155628827 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155632903 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155625954 missense possibly damaging 0.95
IGL02992:Myh7b APN 2 155621410 missense probably damaging 0.99
IGL03060:Myh7b APN 2 155632751 missense probably damaging 1.00
IGL03061:Myh7b APN 2 155620111 missense possibly damaging 0.93
IGL03226:Myh7b APN 2 155620483 nonsense probably null
IGL03246:Myh7b APN 2 155617872 missense probably damaging 1.00
IGL03382:Myh7b APN 2 155623479 missense probably damaging 1.00
euclidian UTSW 2 155633399 missense probably benign 0.32
imaginary UTSW 2 155632255 missense probably benign 0.36
Irrational UTSW 2 155630672 unclassified probably benign
Muscoli UTSW 2 155620118 nonsense probably null
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0109:Myh7b UTSW 2 155611674 missense possibly damaging 0.92
R0309:Myh7b UTSW 2 155630672 unclassified probably benign
R0567:Myh7b UTSW 2 155626398 missense probably damaging 1.00
R0619:Myh7b UTSW 2 155611722 missense probably benign 0.00
R0927:Myh7b UTSW 2 155620120 missense probably damaging 1.00
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0974:Myh7b UTSW 2 155620427 missense probably benign
R1137:Myh7b UTSW 2 155622714 missense probably damaging 1.00
R1261:Myh7b UTSW 2 155621083 missense probably benign 0.00
R1268:Myh7b UTSW 2 155614046 nonsense probably null
R1537:Myh7b UTSW 2 155631787 missense probably damaging 0.96
R1632:Myh7b UTSW 2 155620525 missense probably benign 0.04
R1694:Myh7b UTSW 2 155613193 missense probably damaging 0.99
R1697:Myh7b UTSW 2 155620134 missense probably damaging 1.00
R1730:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R1762:Myh7b UTSW 2 155630858 missense probably damaging 0.96
R1783:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R2105:Myh7b UTSW 2 155629457 missense probably benign 0.00
R2140:Myh7b UTSW 2 155620123 missense probably damaging 1.00
R2971:Myh7b UTSW 2 155632255 missense probably benign 0.36
R3838:Myh7b UTSW 2 155632989 missense probably damaging 1.00
R4074:Myh7b UTSW 2 155618758 missense probably damaging 0.96
R4191:Myh7b UTSW 2 155633399 missense probably benign 0.32
R4689:Myh7b UTSW 2 155630514 missense possibly damaging 0.75
R4695:Myh7b UTSW 2 155614177 missense probably damaging 1.00
R4697:Myh7b UTSW 2 155629322 missense probably damaging 1.00
R4771:Myh7b UTSW 2 155626394 nonsense probably null
R4794:Myh7b UTSW 2 155623266 missense probably benign 0.00
R4842:Myh7b UTSW 2 155633989 missense probably benign 0.45
R4871:Myh7b UTSW 2 155613500 missense probably benign 0.18
R5022:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5023:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5025:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5050:Myh7b UTSW 2 155631750 missense probably benign 0.00
R5055:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5056:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5161:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5284:Myh7b UTSW 2 155632314 missense probably benign
R5422:Myh7b UTSW 2 155631034 missense probably damaging 0.99
R5505:Myh7b UTSW 2 155632672 missense probably benign 0.01
R5946:Myh7b UTSW 2 155621395 missense probably damaging 1.00
R6089:Myh7b UTSW 2 155622489 missense probably damaging 1.00
R6103:Myh7b UTSW 2 155618743 missense probably damaging 1.00
R6233:Myh7b UTSW 2 155631799 missense possibly damaging 0.85
R6292:Myh7b UTSW 2 155632396 missense probably damaging 1.00
R6350:Myh7b UTSW 2 155628760 missense probably benign 0.00
R6484:Myh7b UTSW 2 155628643 missense probably benign 0.05
R6760:Myh7b UTSW 2 155620118 nonsense probably null
R6896:Myh7b UTSW 2 155622568 critical splice donor site probably null
R6945:Myh7b UTSW 2 155622232 missense possibly damaging 0.95
R7020:Myh7b UTSW 2 155631751 missense possibly damaging 0.56
R7052:Myh7b UTSW 2 155614133 missense probably damaging 1.00
R7102:Myh7b UTSW 2 155622199 missense probably damaging 1.00
R7248:Myh7b UTSW 2 155622186 missense probably damaging 1.00
R7303:Myh7b UTSW 2 155618740 missense probably damaging 1.00
R7360:Myh7b UTSW 2 155632540 missense probably benign 0.38
R7652:Myh7b UTSW 2 155632236 missense probably damaging 0.99
R7678:Myh7b UTSW 2 155617778 splice site probably null
R7703:Myh7b UTSW 2 155620436 missense probably null 1.00
R7711:Myh7b UTSW 2 155620403 missense probably damaging 1.00
R7923:Myh7b UTSW 2 155625966 missense probably benign
R7967:Myh7b UTSW 2 155614199 splice site probably null
R8045:Myh7b UTSW 2 155613181 missense probably benign 0.00
R8176:Myh7b UTSW 2 155625966 missense probably benign 0.06
R8272:Myh7b UTSW 2 155632904 missense probably damaging 1.00
R8560:Myh7b UTSW 2 155623204 missense possibly damaging 0.93
R8706:Myh7b UTSW 2 155611749 critical splice donor site probably null
R8824:Myh7b UTSW 2 155630381 missense probably benign 0.02
R8832:Myh7b UTSW 2 155633262 missense probably benign 0.00
R9079:Myh7b UTSW 2 155623254 missense probably damaging 0.97
R9151:Myh7b UTSW 2 155632519 missense probably damaging 1.00
R9311:Myh7b UTSW 2 155621333 missense probably damaging 1.00
R9332:Myh7b UTSW 2 155628802 missense probably damaging 1.00
R9357:Myh7b UTSW 2 155621348 missense probably damaging 1.00
X0013:Myh7b UTSW 2 155631169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAGTAGCTGGCACCTAGAC -3'
(R):5'- AAAGAGCTCTGTCCCCAGAC -3'

Sequencing Primer
(F):5'- CTAGACCACGATCCAAGGGG -3'
(R):5'- TCTGTCCCCAGACCTCGAG -3'
Posted On 2022-04-18