Incidental Mutation 'R9388:Abca14'
ID 710430
Institutional Source Beutler Lab
Gene Symbol Abca14
Ensembl Gene ENSMUSG00000062017
Gene Name ATP-binding cassette, sub-family A member 14
Synonyms 1700110B15Rik, 4930539G24Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9388 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 119803184-119924575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119882261 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1141 (D1141G)
Ref Sequence ENSEMBL: ENSMUSP00000081690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084640]
AlphaFold E9Q8F8
Predicted Effect probably benign
Transcript: ENSMUST00000084640
AA Change: D1141G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017
AA Change: D1141G

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (53/53)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T A 5: 113,338,714 (GRCm39) T433S probably benign Het
Abca17 A G 17: 24,483,273 (GRCm39) S1728P unknown Het
Adam29 A C 8: 56,325,285 (GRCm39) C390G probably damaging Het
Angptl4 G A 17: 33,996,158 (GRCm39) R273* probably null Het
Arfgef3 T C 10: 18,505,877 (GRCm39) N929S probably benign Het
Baiap3 A G 17: 25,466,109 (GRCm39) probably null Het
Btla T C 16: 45,059,454 (GRCm39) S53P probably damaging Het
Cand1 A G 10: 119,047,213 (GRCm39) F759S possibly damaging Het
Cbll1 T C 12: 31,541,567 (GRCm39) T104A probably benign Het
Chd7 A G 4: 8,865,756 (GRCm39) M2688V possibly damaging Het
Cnot3 C A 7: 3,661,367 (GRCm39) H625Q possibly damaging Het
Dbn1 T C 13: 55,624,088 (GRCm39) I381V probably benign Het
Dennd2d T A 3: 106,395,915 (GRCm39) N135K possibly damaging Het
Dnah7c T C 1: 46,779,886 (GRCm39) I3196T probably damaging Het
Dock2 C A 11: 34,212,460 (GRCm39) R1227L possibly damaging Het
Esr1 A G 10: 4,919,179 (GRCm39) E423G probably benign Het
Ganab A G 19: 8,892,302 (GRCm39) Q826R probably damaging Het
Herc4 T A 10: 63,143,522 (GRCm39) M684K probably benign Het
Hipk2 A G 6: 38,707,956 (GRCm39) L613P probably damaging Het
Hpf1 A T 8: 61,353,182 (GRCm39) I188L probably benign Het
Ifnar1 C T 16: 91,292,367 (GRCm39) P207L probably benign Het
Il4 C T 11: 53,504,837 (GRCm39) R76H probably damaging Het
Kif1a C A 1: 93,000,029 (GRCm39) probably null Het
Kng1 A T 16: 22,898,388 (GRCm39) Y596F possibly damaging Het
Lrrc8d T A 5: 105,961,862 (GRCm39) H757Q probably damaging Het
Med24 A T 11: 98,600,893 (GRCm39) I600N possibly damaging Het
Mmp10 G A 9: 7,504,170 (GRCm39) W203* probably null Het
Mnt C T 11: 74,727,450 (GRCm39) A112V probably benign Het
Myh7b A T 2: 155,472,983 (GRCm39) N1415Y probably benign Het
Nipal1 T A 5: 72,825,557 (GRCm39) *417R probably null Het
Nlrp4c C T 7: 6,069,874 (GRCm39) Q592* probably null Het
Obscn T C 11: 58,943,489 (GRCm39) E4220G probably damaging Het
Or10al7 C T 17: 38,366,148 (GRCm39) C103Y probably damaging Het
Or13a23-ps1 G T 7: 140,118,928 (GRCm39) C166F unknown Het
Or2w1b T C 13: 21,300,774 (GRCm39) L304P probably damaging Het
Or5aq6 A T 2: 86,923,390 (GRCm39) M117K possibly damaging Het
Pcdhb20 A T 18: 37,638,853 (GRCm39) I460F probably benign Het
Prb1b T C 6: 132,289,437 (GRCm39) Q129R unknown Het
Primpol G A 8: 47,034,605 (GRCm39) T441I possibly damaging Het
Ptprc A G 1: 138,011,380 (GRCm39) V583A possibly damaging Het
Rfx6 T C 10: 51,554,117 (GRCm39) V71A possibly damaging Het
Rgsl1 T C 1: 153,693,355 (GRCm39) I574V probably benign Het
Rims3 A G 4: 120,748,552 (GRCm39) I258V possibly damaging Het
Sec16b T C 1: 157,388,393 (GRCm39) Y776H probably benign Het
Skint6 C T 4: 113,049,838 (GRCm39) D276N possibly damaging Het
Slc45a1 T C 4: 150,727,067 (GRCm39) D184G probably damaging Het
St6galnac4 A T 2: 32,479,625 (GRCm39) S61C probably damaging Het
Stab1 C T 14: 30,876,312 (GRCm39) V926M probably damaging Het
Stat1 A T 1: 52,193,037 (GRCm39) K642N possibly damaging Het
Tmprss3 A G 17: 31,410,041 (GRCm39) F191S probably damaging Het
Ube2o T C 11: 116,430,210 (GRCm39) D1176G possibly damaging Het
Usp17ld G T 7: 102,900,145 (GRCm39) N262K probably benign Het
Xpnpep1 T C 19: 52,993,233 (GRCm39) K365E probably damaging Het
Other mutations in Abca14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Abca14 APN 7 119,846,076 (GRCm39) missense probably damaging 1.00
IGL00800:Abca14 APN 7 119,854,613 (GRCm39) missense probably benign 0.01
IGL00845:Abca14 APN 7 119,823,174 (GRCm39) splice site probably benign
IGL00897:Abca14 APN 7 119,815,348 (GRCm39) splice site probably benign
IGL01524:Abca14 APN 7 119,852,644 (GRCm39) missense possibly damaging 0.57
IGL01747:Abca14 APN 7 119,877,310 (GRCm39) missense probably benign 0.00
IGL02214:Abca14 APN 7 119,893,398 (GRCm39) missense probably benign 0.09
IGL02215:Abca14 APN 7 119,852,612 (GRCm39) missense probably benign 0.00
IGL02253:Abca14 APN 7 119,807,182 (GRCm39) missense probably benign 0.29
IGL02302:Abca14 APN 7 119,917,968 (GRCm39) splice site probably benign
IGL03391:Abca14 APN 7 119,846,107 (GRCm39) missense probably damaging 1.00
F6893:Abca14 UTSW 7 119,924,261 (GRCm39) missense probably damaging 0.98
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0265:Abca14 UTSW 7 119,822,850 (GRCm39) missense probably benign 0.03
R0326:Abca14 UTSW 7 119,823,642 (GRCm39) missense probably damaging 1.00
R0380:Abca14 UTSW 7 119,877,703 (GRCm39) missense probably benign 0.03
R0418:Abca14 UTSW 7 119,806,657 (GRCm39) missense probably damaging 1.00
R0539:Abca14 UTSW 7 119,807,020 (GRCm39) missense probably damaging 1.00
R0574:Abca14 UTSW 7 119,823,720 (GRCm39) missense probably damaging 0.96
R0611:Abca14 UTSW 7 119,851,479 (GRCm39) missense possibly damaging 0.63
R0783:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0785:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0863:Abca14 UTSW 7 119,815,453 (GRCm39) missense probably benign 0.03
R1034:Abca14 UTSW 7 119,815,370 (GRCm39) missense probably damaging 1.00
R1056:Abca14 UTSW 7 119,924,295 (GRCm39) missense probably damaging 1.00
R1072:Abca14 UTSW 7 119,811,992 (GRCm39) missense probably benign
R1244:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1255:Abca14 UTSW 7 119,807,016 (GRCm39) missense probably damaging 0.97
R1271:Abca14 UTSW 7 119,924,340 (GRCm39) missense probably damaging 1.00
R1325:Abca14 UTSW 7 119,846,545 (GRCm39) missense probably benign 0.32
R1457:Abca14 UTSW 7 119,888,683 (GRCm39) missense probably benign 0.00
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1494:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R1551:Abca14 UTSW 7 119,918,101 (GRCm39) missense probably benign 0.10
R1607:Abca14 UTSW 7 119,850,514 (GRCm39) missense probably damaging 1.00
R1739:Abca14 UTSW 7 119,877,529 (GRCm39) missense probably benign 0.04
R1856:Abca14 UTSW 7 119,877,404 (GRCm39) missense probably damaging 1.00
R1875:Abca14 UTSW 7 119,847,190 (GRCm39) missense possibly damaging 0.78
R1892:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1898:Abca14 UTSW 7 119,850,392 (GRCm39) missense probably damaging 1.00
R1958:Abca14 UTSW 7 119,924,382 (GRCm39) missense probably damaging 0.98
R2018:Abca14 UTSW 7 119,815,408 (GRCm39) missense probably benign 0.00
R2039:Abca14 UTSW 7 119,911,487 (GRCm39) missense probably damaging 0.98
R2060:Abca14 UTSW 7 119,826,741 (GRCm39) nonsense probably null
R2202:Abca14 UTSW 7 119,888,764 (GRCm39) missense probably benign 0.17
R2205:Abca14 UTSW 7 119,846,503 (GRCm39) missense probably damaging 0.98
R2360:Abca14 UTSW 7 119,850,431 (GRCm39) missense probably benign 0.00
R2401:Abca14 UTSW 7 119,882,312 (GRCm39) missense probably damaging 1.00
R2426:Abca14 UTSW 7 119,882,446 (GRCm39) missense probably benign 0.04
R3433:Abca14 UTSW 7 119,893,455 (GRCm39) missense probably damaging 0.97
R4598:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4599:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4700:Abca14 UTSW 7 119,911,928 (GRCm39) critical splice donor site probably null
R4751:Abca14 UTSW 7 119,911,400 (GRCm39) missense probably benign 0.01
R4826:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4828:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4837:Abca14 UTSW 7 119,846,203 (GRCm39) missense probably benign
R4881:Abca14 UTSW 7 119,877,472 (GRCm39) missense possibly damaging 0.49
R4895:Abca14 UTSW 7 119,846,572 (GRCm39) critical splice donor site probably null
R4928:Abca14 UTSW 7 119,923,803 (GRCm39) missense possibly damaging 0.90
R4990:Abca14 UTSW 7 119,911,388 (GRCm39) missense probably benign 0.00
R5027:Abca14 UTSW 7 119,911,505 (GRCm39) missense probably benign 0.05
R5091:Abca14 UTSW 7 119,851,497 (GRCm39) missense probably damaging 1.00
R5158:Abca14 UTSW 7 119,852,652 (GRCm39) missense probably benign
R5209:Abca14 UTSW 7 119,832,130 (GRCm39) missense probably benign 0.01
R5333:Abca14 UTSW 7 119,888,769 (GRCm39) nonsense probably null
R5424:Abca14 UTSW 7 119,810,777 (GRCm39) missense probably benign 0.01
R5488:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5489:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5716:Abca14 UTSW 7 119,846,217 (GRCm39) critical splice donor site probably null
R6450:Abca14 UTSW 7 119,815,449 (GRCm39) missense probably benign 0.17
R6477:Abca14 UTSW 7 119,924,325 (GRCm39) missense probably benign 0.44
R6652:Abca14 UTSW 7 119,846,164 (GRCm39) missense probably damaging 1.00
R6782:Abca14 UTSW 7 119,847,308 (GRCm39) missense probably damaging 1.00
R6874:Abca14 UTSW 7 119,851,428 (GRCm39) missense possibly damaging 0.71
R6965:Abca14 UTSW 7 119,882,452 (GRCm39) nonsense probably null
R7142:Abca14 UTSW 7 119,850,406 (GRCm39) missense possibly damaging 0.89
R7146:Abca14 UTSW 7 119,854,520 (GRCm39) missense probably benign 0.15
R7202:Abca14 UTSW 7 119,917,236 (GRCm39) missense probably damaging 1.00
R7220:Abca14 UTSW 7 119,826,667 (GRCm39) missense possibly damaging 0.45
R7241:Abca14 UTSW 7 119,846,184 (GRCm39) missense probably damaging 1.00
R7291:Abca14 UTSW 7 119,888,832 (GRCm39) nonsense probably null
R7296:Abca14 UTSW 7 119,877,534 (GRCm39) missense probably benign
R7298:Abca14 UTSW 7 119,807,106 (GRCm39) missense probably benign 0.00
R7315:Abca14 UTSW 7 119,893,341 (GRCm39) missense probably benign 0.00
R7776:Abca14 UTSW 7 119,832,214 (GRCm39) critical splice donor site probably null
R7820:Abca14 UTSW 7 119,811,944 (GRCm39) missense probably benign 0.42
R7873:Abca14 UTSW 7 119,888,792 (GRCm39) missense probably benign 0.17
R8215:Abca14 UTSW 7 119,893,425 (GRCm39) missense probably benign
R8332:Abca14 UTSW 7 119,815,436 (GRCm39) missense probably benign
R8419:Abca14 UTSW 7 119,815,489 (GRCm39) missense probably benign 0.08
R8444:Abca14 UTSW 7 119,918,133 (GRCm39) missense probably damaging 1.00
R8818:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R8834:Abca14 UTSW 7 119,877,372 (GRCm39) missense probably benign 0.02
R8845:Abca14 UTSW 7 119,846,428 (GRCm39) missense probably benign 0.00
R8889:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8892:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8894:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably damaging 1.00
R8903:Abca14 UTSW 7 119,815,526 (GRCm39) missense probably damaging 0.98
R8950:Abca14 UTSW 7 119,823,595 (GRCm39) missense possibly damaging 0.92
R8950:Abca14 UTSW 7 119,823,644 (GRCm39) nonsense probably null
R9018:Abca14 UTSW 7 119,918,532 (GRCm39) missense probably damaging 0.98
R9018:Abca14 UTSW 7 119,888,763 (GRCm39) missense probably benign 0.01
R9110:Abca14 UTSW 7 119,831,615 (GRCm39) intron probably benign
R9254:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9376:Abca14 UTSW 7 119,893,438 (GRCm39) missense probably damaging 1.00
R9378:Abca14 UTSW 7 119,807,191 (GRCm39) missense possibly damaging 0.64
R9379:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9445:Abca14 UTSW 7 119,877,691 (GRCm39) missense probably benign 0.05
R9522:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably null 0.98
R9577:Abca14 UTSW 7 119,810,768 (GRCm39) missense probably benign 0.27
R9627:Abca14 UTSW 7 119,854,530 (GRCm39) missense probably benign 0.00
R9639:Abca14 UTSW 7 119,893,345 (GRCm39) missense probably benign 0.01
R9660:Abca14 UTSW 7 119,851,478 (GRCm39) missense probably benign 0.00
R9696:Abca14 UTSW 7 119,888,734 (GRCm39) missense possibly damaging 0.59
R9709:Abca14 UTSW 7 119,888,739 (GRCm39) nonsense probably null
R9780:Abca14 UTSW 7 119,911,447 (GRCm39) missense probably benign 0.00
Z1088:Abca14 UTSW 7 119,815,358 (GRCm39) missense probably benign 0.14
Z1176:Abca14 UTSW 7 119,846,146 (GRCm39) missense probably damaging 1.00
Z1177:Abca14 UTSW 7 119,917,210 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGGTCATTTAGGGCAAATTG -3'
(R):5'- ATGATTTGTACCACAGCATCCAC -3'

Sequencing Primer
(F):5'- GGGTCATTTAGGGCAAATTGTTAAC -3'
(R):5'- GTACCACAGCATCCACAATTATACTG -3'
Posted On 2022-04-18