Incidental Mutation 'R9388:Olfr1369-ps1'
ID 710448
Institutional Source Beutler Lab
Gene Symbol Olfr1369-ps1
Ensembl Gene ENSMUSG00000060404
Gene Name olfactory receptor 1369, pseudogene 1
Synonyms GA_x6K02T2QHY8-12126170-12125935, MOR256-31
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock # R9388 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 21111483-21119095 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21116604 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 304 (L304P)
Ref Sequence ENSEMBL: ENSMUSP00000150565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079050] [ENSMUST00000213326] [ENSMUST00000213922] [ENSMUST00000215207] [ENSMUST00000215941]
AlphaFold A0A140T8K7
Predicted Effect probably damaging
Transcript: ENSMUST00000079050
AA Change: L304P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078059
Gene: ENSMUSG00000060404
AA Change: L304P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.2e-47 PFAM
Pfam:7tm_1 41 290 1.1e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213326
AA Change: L304P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000213922
AA Change: L304P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000215207
AA Change: L304P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000215941
AA Change: L304P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T A 5: 113,190,848 T433S probably benign Het
Abca14 A G 7: 120,283,038 D1141G probably benign Het
Abca17 A G 17: 24,264,299 S1728P unknown Het
Adam29 A C 8: 55,872,250 C390G probably damaging Het
Angptl4 G A 17: 33,777,184 R273* probably null Het
Arfgef3 T C 10: 18,630,129 N929S probably benign Het
Baiap3 A G 17: 25,247,135 probably null Het
Btla T C 16: 45,239,091 S53P probably damaging Het
Cand1 A G 10: 119,211,308 F759S possibly damaging Het
Cbll1 T C 12: 31,491,568 T104A probably benign Het
Chd7 A G 4: 8,865,756 M2688V possibly damaging Het
Cnot3 C A 7: 3,658,368 H625Q possibly damaging Het
Dbn1 T C 13: 55,476,275 I381V probably benign Het
Dennd2d T A 3: 106,488,599 N135K possibly damaging Het
Dnah7c T C 1: 46,740,726 I3196T probably damaging Het
Dock2 C A 11: 34,262,460 R1227L possibly damaging Het
Esr1 A G 10: 4,969,179 E423G probably benign Het
Ganab A G 19: 8,914,938 Q826R probably damaging Het
Herc4 T A 10: 63,307,743 M684K probably benign Het
Hipk2 A G 6: 38,731,021 L613P probably damaging Het
Hpf1 A T 8: 60,900,148 I188L probably benign Het
Ifnar1 C T 16: 91,495,479 P207L probably benign Het
Il4 C T 11: 53,614,010 R76H probably damaging Het
Kif1a C A 1: 93,072,307 probably null Het
Kng1 A T 16: 23,079,638 Y596F possibly damaging Het
Lrrc8d T A 5: 105,813,996 H757Q probably damaging Het
Med24 A T 11: 98,710,067 I600N possibly damaging Het
Mmp10 G A 9: 7,504,169 W203* probably null Het
Mnt C T 11: 74,836,624 A112V probably benign Het
Myh7b A T 2: 155,631,063 N1415Y probably benign Het
Nipal1 T A 5: 72,668,214 *417R probably null Het
Nlrp4c C T 7: 6,066,875 Q592* probably null Het
Obscn T C 11: 59,052,663 E4220G probably damaging Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr129 C T 17: 38,055,257 C103Y probably damaging Het
Olfr537-ps1 G T 7: 140,539,015 C166F unknown Het
Pcdhb20 A T 18: 37,505,800 I460F probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Primpol G A 8: 46,581,570 T441I possibly damaging Het
Prpmp5 T C 6: 132,312,474 Q129R unknown Het
Ptprc A G 1: 138,083,642 V583A possibly damaging Het
Rfx6 T C 10: 51,678,021 V71A possibly damaging Het
Rgsl1 T C 1: 153,817,609 I574V probably benign Het
Rims3 A G 4: 120,891,355 I258V possibly damaging Het
Sec16b T C 1: 157,560,823 Y776H probably benign Het
Skint6 C T 4: 113,192,641 D276N possibly damaging Het
Slc45a1 T C 4: 150,642,610 D184G probably damaging Het
St6galnac4 A T 2: 32,589,613 S61C probably damaging Het
Stab1 C T 14: 31,154,355 V926M probably damaging Het
Stat1 A T 1: 52,153,878 K642N possibly damaging Het
Tmprss3 A G 17: 31,191,067 F191S probably damaging Het
Ube2o T C 11: 116,539,384 D1176G possibly damaging Het
Usp17ld G T 7: 103,250,938 N262K probably benign Het
Xpnpep1 T C 19: 53,004,802 K365E probably damaging Het
Other mutations in Olfr1369-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01689:Olfr1369-ps1 APN 13 21116073 missense probably damaging 0.97
R0631:Olfr1369-ps1 UTSW 13 21115908 missense probably damaging 1.00
R0960:Olfr1369-ps1 UTSW 13 21116265 missense possibly damaging 0.94
R1499:Olfr1369-ps1 UTSW 13 21116133 missense probably benign 0.32
R1549:Olfr1369-ps1 UTSW 13 21116118 missense probably benign 0.01
R1698:Olfr1369-ps1 UTSW 13 21116565 missense probably benign 0.11
R1711:Olfr1369-ps1 UTSW 13 21116306 missense probably benign 0.01
R2404:Olfr1369-ps1 UTSW 13 21115842 missense probably damaging 1.00
R2471:Olfr1369-ps1 UTSW 13 21116429 missense probably damaging 1.00
R3844:Olfr1369-ps1 UTSW 13 21116063 missense possibly damaging 0.91
R3977:Olfr1369-ps1 UTSW 13 21115861 missense probably benign 0.03
R3979:Olfr1369-ps1 UTSW 13 21115861 missense probably benign 0.03
R4804:Olfr1369-ps1 UTSW 13 21116005 nonsense probably null
R4914:Olfr1369-ps1 UTSW 13 21116397 missense probably benign 0.12
R5210:Olfr1369-ps1 UTSW 13 21116052 missense probably damaging 0.99
R5359:Olfr1369-ps1 UTSW 13 21116267 missense probably damaging 1.00
R5700:Olfr1369-ps1 UTSW 13 21116001 missense probably damaging 1.00
R6218:Olfr1369-ps1 UTSW 13 21116231 missense probably damaging 1.00
R6767:Olfr1369-ps1 UTSW 13 21116057 missense probably benign 0.02
R7396:Olfr1369-ps1 UTSW 13 21116307 missense probably benign 0.02
R7476:Olfr1369-ps1 UTSW 13 21116021 missense probably benign 0.04
R7612:Olfr1369-ps1 UTSW 13 21116047 missense probably damaging 0.99
R8257:Olfr1369-ps1 UTSW 13 21116373 missense probably benign 0.11
V8831:Olfr1369-ps1 UTSW 13 21116003 missense possibly damaging 0.93
Z1176:Olfr1369-ps1 UTSW 13 21116601 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATCCCATCTCACTGTGG -3'
(R):5'- CATGTCTTCTTGGAGAACATGCC -3'

Sequencing Primer
(F):5'- TCACTGTGGTCTCCATATTCTATG -3'
(R):5'- GTCTTCTTGGAGAACATGCCAATAG -3'
Posted On 2022-04-18