Incidental Mutation 'R9388:Xpnpep1'
ID 710461
Institutional Source Beutler Lab
Gene Symbol Xpnpep1
Ensembl Gene ENSMUSG00000025027
Gene Name X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Synonyms D230045I08Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9388 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 52943417-53040214 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53004802 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 365 (K365E)
Ref Sequence ENSEMBL: ENSMUSP00000138250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182500] [ENSMUST00000183108] [ENSMUST00000183274]
AlphaFold Q6P1B1
Predicted Effect probably benign
Transcript: ENSMUST00000182500
Predicted Effect probably damaging
Transcript: ENSMUST00000183108
AA Change: K365E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138250
Gene: ENSMUSG00000025027
AA Change: K365E

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 5.5e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183274
AA Change: K365E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138233
Gene: ENSMUSG00000025027
AA Change: K365E

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 1.9e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of a metalloaminopeptidase that catalyzes the cleavage of the N-terminal amino acid adjacent to a proline residue. The gene product may play a role in degradation and maturation of tachykinins, neuropeptides, and peptide hormones. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit pre and postnatal lethality, reduced male survival, growth retardation with decreased body weight, size and length, microcephaly and peptiduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T A 5: 113,190,848 T433S probably benign Het
Abca14 A G 7: 120,283,038 D1141G probably benign Het
Abca17 A G 17: 24,264,299 S1728P unknown Het
Adam29 A C 8: 55,872,250 C390G probably damaging Het
Angptl4 G A 17: 33,777,184 R273* probably null Het
Arfgef3 T C 10: 18,630,129 N929S probably benign Het
Baiap3 A G 17: 25,247,135 probably null Het
Btla T C 16: 45,239,091 S53P probably damaging Het
Cand1 A G 10: 119,211,308 F759S possibly damaging Het
Cbll1 T C 12: 31,491,568 T104A probably benign Het
Chd7 A G 4: 8,865,756 M2688V possibly damaging Het
Cnot3 C A 7: 3,658,368 H625Q possibly damaging Het
Dbn1 T C 13: 55,476,275 I381V probably benign Het
Dennd2d T A 3: 106,488,599 N135K possibly damaging Het
Dnah7c T C 1: 46,740,726 I3196T probably damaging Het
Dock2 C A 11: 34,262,460 R1227L possibly damaging Het
Esr1 A G 10: 4,969,179 E423G probably benign Het
Ganab A G 19: 8,914,938 Q826R probably damaging Het
Herc4 T A 10: 63,307,743 M684K probably benign Het
Hipk2 A G 6: 38,731,021 L613P probably damaging Het
Hpf1 A T 8: 60,900,148 I188L probably benign Het
Ifnar1 C T 16: 91,495,479 P207L probably benign Het
Il4 C T 11: 53,614,010 R76H probably damaging Het
Kif1a C A 1: 93,072,307 probably null Het
Kng1 A T 16: 23,079,638 Y596F possibly damaging Het
Lrrc8d T A 5: 105,813,996 H757Q probably damaging Het
Med24 A T 11: 98,710,067 I600N possibly damaging Het
Mmp10 G A 9: 7,504,169 W203* probably null Het
Mnt C T 11: 74,836,624 A112V probably benign Het
Myh7b A T 2: 155,631,063 N1415Y probably benign Het
Nipal1 T A 5: 72,668,214 *417R probably null Het
Nlrp4c C T 7: 6,066,875 Q592* probably null Het
Obscn T C 11: 59,052,663 E4220G probably damaging Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr129 C T 17: 38,055,257 C103Y probably damaging Het
Olfr1369-ps1 T C 13: 21,116,604 L304P probably damaging Het
Olfr537-ps1 G T 7: 140,539,015 C166F unknown Het
Pcdhb20 A T 18: 37,505,800 I460F probably benign Het
Primpol G A 8: 46,581,570 T441I possibly damaging Het
Prpmp5 T C 6: 132,312,474 Q129R unknown Het
Ptprc A G 1: 138,083,642 V583A possibly damaging Het
Rfx6 T C 10: 51,678,021 V71A possibly damaging Het
Rgsl1 T C 1: 153,817,609 I574V probably benign Het
Rims3 A G 4: 120,891,355 I258V possibly damaging Het
Sec16b T C 1: 157,560,823 Y776H probably benign Het
Skint6 C T 4: 113,192,641 D276N possibly damaging Het
Slc45a1 T C 4: 150,642,610 D184G probably damaging Het
St6galnac4 A T 2: 32,589,613 S61C probably damaging Het
Stab1 C T 14: 31,154,355 V926M probably damaging Het
Stat1 A T 1: 52,153,878 K642N possibly damaging Het
Tmprss3 A G 17: 31,191,067 F191S probably damaging Het
Ube2o T C 11: 116,539,384 D1176G possibly damaging Het
Usp17ld G T 7: 103,250,938 N262K probably benign Het
Other mutations in Xpnpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Xpnpep1 APN 19 53010148 missense probably benign 0.06
IGL01665:Xpnpep1 APN 19 52997032 missense probably benign 0.00
IGL01833:Xpnpep1 APN 19 53000393 missense probably damaging 1.00
IGL02011:Xpnpep1 APN 19 53002465 critical splice donor site probably benign 0.00
IGL03229:Xpnpep1 APN 19 53025380 missense probably benign
IGL03334:Xpnpep1 APN 19 53010146 missense probably damaging 1.00
R0226:Xpnpep1 UTSW 19 53010152 missense probably benign 0.03
R0613:Xpnpep1 UTSW 19 53006353 missense probably damaging 0.97
R0648:Xpnpep1 UTSW 19 52997863 splice site probably benign
R1543:Xpnpep1 UTSW 19 52991676 missense probably benign 0.24
R1553:Xpnpep1 UTSW 19 53006338 missense probably benign 0.00
R1801:Xpnpep1 UTSW 19 53010133 missense probably damaging 1.00
R1853:Xpnpep1 UTSW 19 53006210 missense probably benign 0.01
R2234:Xpnpep1 UTSW 19 53013461 missense probably damaging 1.00
R3797:Xpnpep1 UTSW 19 53006342 missense probably benign 0.28
R3820:Xpnpep1 UTSW 19 53003819 splice site probably benign
R3822:Xpnpep1 UTSW 19 53003819 splice site probably benign
R3925:Xpnpep1 UTSW 19 52991697 missense probably damaging 1.00
R4831:Xpnpep1 UTSW 19 53014622 missense probably benign 0.09
R5033:Xpnpep1 UTSW 19 53006175 missense probably benign
R5184:Xpnpep1 UTSW 19 53013414 missense probably benign 0.24
R5468:Xpnpep1 UTSW 19 52995519 missense probably benign 0.01
R5573:Xpnpep1 UTSW 19 53004822 missense probably damaging 1.00
R5876:Xpnpep1 UTSW 19 52997008 missense probably damaging 1.00
R5929:Xpnpep1 UTSW 19 53013489 missense probably damaging 1.00
R6454:Xpnpep1 UTSW 19 52997879 missense possibly damaging 0.91
R6519:Xpnpep1 UTSW 19 53011844 missense possibly damaging 0.90
R7095:Xpnpep1 UTSW 19 53011765 critical splice donor site probably null
R7112:Xpnpep1 UTSW 19 53010107 missense probably benign
R7412:Xpnpep1 UTSW 19 53006291 missense probably benign
R8329:Xpnpep1 UTSW 19 53002472 critical splice donor site probably null
R8431:Xpnpep1 UTSW 19 52995506 missense probably benign 0.04
R9194:Xpnpep1 UTSW 19 53011858 missense possibly damaging 0.68
R9342:Xpnpep1 UTSW 19 53004817 missense probably benign 0.02
R9546:Xpnpep1 UTSW 19 53002528 missense probably damaging 1.00
R9746:Xpnpep1 UTSW 19 53013461 missense probably damaging 1.00
RF017:Xpnpep1 UTSW 19 53032060 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CACCCTGTACACTGCATGGG -3'
(R):5'- TGAACACGTCCGAGCATC -3'

Sequencing Primer
(F):5'- TAGCATCAGATCTCCTGGGACTAG -3'
(R):5'- ATCAGCTGCCGTGACAGGAC -3'
Posted On 2022-04-18