Mutagenetix > Incidental Mutation

Incidental Mutation 'R9389:Srgap2'

710463

Institutional Source

Beutler Lab

Gene Symbol

Srgap2

Ensembl Gene

ENSMUSG00000026425

Gene Name

SLIT-ROBO Rho GTPase activating protein 2

Synonyms

FBP2, Fnbp2, 9930124L22Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9389 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

131285251-131527352 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 131355627 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 239 (Y239H)

Ref Sequence

ENSEMBL: ENSMUSP00000095195 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097588] [ENSMUST00000185596] [ENSMUST00000186543]

AlphaFold

Q91Z67

Predicted Effect

probably damaging
Transcript: ENSMUST00000097588
AA Change: Y239H

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000095195
Gene: ENSMUSG00000026425
AA Change: Y239H

Domain	Start	End	E-Value	Type
FCH	22	120	7.33e-18	SMART
low complexity region	178	191	N/A	INTRINSIC
coiled coil region	363	401	N/A	INTRINSIC
Blast:RhoGAP	445	490	7e-12	BLAST
RhoGAP	502	676	9.6e-60	SMART
SH3	731	786	4.52e-15	SMART
low complexity region	852	868	N/A	INTRINSIC
coiled coil region	940	967	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000185596
AA Change: Y98H

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000141140
Gene: ENSMUSG00000026425
AA Change: Y98H

Domain	Start	End	E-Value	Type
low complexity region	37	50	N/A	INTRINSIC
coiled coil region	222	260	N/A	INTRINSIC
Blast:RhoGAP	304	349	5e-12	BLAST
RhoGAP	361	535	5.9e-62	SMART
SH3	590	645	2.8e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186543
AA Change: Y239H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000139405
Gene: ENSMUSG00000026425
AA Change: Y239H

Domain	Start	End	E-Value	Type
FCH	22	120	3.7e-20	SMART
low complexity region	178	191	N/A	INTRINSIC
coiled coil region	363	401	N/A	INTRINSIC
Blast:RhoGAP	445	490	7e-12	BLAST
RhoGAP	502	676	5.9e-62	SMART
SH3	731	786	2.8e-17	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the SLIT-ROBO Rho GTPase activating protein family. The encoded protein stimulates GTPase activity of Rac1, and plays a role in cortical neuron development. This locus has several paralogs on human chromosome 1 resulting from segmental duplication. While this locus itself is conserved among various species, the paralogs are found only in the genus Homo, and not in the genomes of non-human great apes. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele are born at below the expected Mendelian ratio, but are otherwise viable. Layer 5 cortical pyramidal neurons exhibit an increased density of dendritic spines with a decreased spine head width and increased length of spine necks. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	C	T	6: 41,033,145	G85D	probably benign	Het
4931440F15Rik	A	G	11: 29,825,107	S117P	probably damaging	Het
Abcb1b	G	A	5: 8,825,614	V596I	probably benign	Het
Agtpbp1	A	T	13: 59,466,070	M1019K	probably damaging	Het
Arfgef3	A	G	10: 18,603,523	V1448A	probably damaging	Het
Baz1a	T	A	12: 54,916,823	E828D	probably damaging	Het
Ces1f	A	T	8: 93,269,972		probably null	Het
Cfap53	T	A	18: 74,299,343		probably null	Het
Col6a4	T	C	9: 106,000,784	Y1998C	probably damaging	Het
Col9a2	A	G	4: 121,054,751	T675A	probably benign	Het
Dusp6	G	A	10: 99,263,977	V96M	possibly damaging	Het
Elmo1	T	G	13: 20,185,491	M22R	probably benign	Het
Gm19965	A	G	1: 116,821,836	N416D		Het
Gpr162	A	G	6: 124,861,394	Y98H	probably damaging	Het
Igfals	G	A	17: 24,881,626	V564I	probably benign	Het
Il4	C	T	11: 53,614,010	R76H	probably damaging	Het
Itgb1	T	A	8: 128,707,156	N50K	probably benign	Het
Itpr3	A	T	17: 27,095,925	Y682F	possibly damaging	Het
Jak3	C	T	8: 71,684,052	P668S	probably damaging	Het
Malrd1	A	T	2: 15,703,156	N932I	unknown	Het
Mast4	C	A	13: 103,333,930	R88L	probably benign	Het
Mfsd11	T	G	11: 116,873,335	S381A	probably benign	Het
Mrm3	A	G	11: 76,250,030	D288G	probably damaging	Het
Myg1	G	T	15: 102,336,937	V198F	probably damaging	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Npy6r	T	C	18: 44,275,692	I60T	probably damaging	Het
Olfr1109	A	T	2: 87,093,046	M117K	possibly damaging	Het
Olfr1308	G	T	2: 111,960,527	P182H	probably damaging	Het
Olfr1341	A	T	4: 118,710,156	M250L	probably benign	Het
Olfr177	C	T	16: 58,872,613	C179Y	probably damaging	Het
Olfr530	T	C	7: 140,373,017	T198A	probably benign	Het
Olfr811	G	A	10: 129,801,671	P285S	probably damaging	Het
Ovgp1	CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA	CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA	3: 105,986,525		probably benign	Het
Oxtr	C	A	6: 112,489,349	R150L	probably damaging	Het
Pappa	A	T	4: 65,180,888	Y548F	probably damaging	Het
Pip4k2a	T	C	2: 18,908,079	K73R	probably damaging	Het
Pla2g4f	T	A	2: 120,302,300	D685V	probably damaging	Het
Ppp1r35	T	A	5: 137,779,315	L81Q	probably damaging	Het
Ptprf	C	A	4: 118,236,039	A469S	probably benign	Het
Ranbp3l	T	A	15: 9,057,223	N322K	probably damaging	Het
Rev3l	T	A	10: 39,822,971	Y1155N	possibly damaging	Het
Rfesd	T	C	13: 76,003,012	Y96C	probably damaging	Het
Runx1	C	T	16: 92,613,680	V283I	possibly damaging	Het
Sema5b	A	C	16: 35,645,722	Q125P	probably damaging	Het
Spef2	A	T	15: 9,725,221	M150K	probably damaging	Het
Srcap	T	G	7: 127,542,283	L1745W	probably damaging	Het
Svil	T	A	18: 5,090,811	H1304Q	possibly damaging	Het
Syne1	T	C	10: 5,229,193	D4427G	possibly damaging	Het
Tg	T	A	15: 66,689,324	M1065K	probably benign	Het
Tgm2	T	C	2: 158,117,896	T656A	probably benign	Het
Ttc37	A	G	13: 76,127,039	D403G	probably benign	Het
Ubr4	A	G	4: 139,425,924	K809E		Het
Vmn1r88	T	C	7: 13,178,619	S301P	probably damaging	Het
Wdr27	A	G	17: 14,891,718	V671A	possibly damaging	Het
Zbtb17	G	A	4: 141,465,820	V550I	possibly damaging	Het
Zeb2	A	T	2: 44,997,908	I379N	probably damaging	Het

Other mutations in Srgap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00677:Srgap2	APN	1	131356700	missense	possibly damaging	0.89
IGL01738:Srgap2	APN	1	131296426	missense	probably benign	0.00
IGL01933:Srgap2	APN	1	131411855	missense	probably damaging	1.00
IGL01964:Srgap2	APN	1	131289578	missense	probably benign	0.08
IGL02028:Srgap2	APN	1	131296435	missense	probably damaging	0.98
IGL02159:Srgap2	APN	1	131319666	splice site	probably benign
IGL02326:Srgap2	APN	1	131356907	critical splice acceptor site	probably null
IGL02396:Srgap2	APN	1	131292675	missense	probably damaging	0.99
IGL02407:Srgap2	APN	1	131319602	missense	probably damaging	1.00
IGL02444:Srgap2	APN	1	131325153	splice site	probably null
IGL02559:Srgap2	APN	1	131524936	critical splice donor site	probably null
IGL02900:Srgap2	APN	1	131411796	splice site	probably benign
IGL03150:Srgap2	APN	1	131310600	missense	probably damaging	1.00
R0008:Srgap2	UTSW	1	131355564	missense	probably damaging	0.99
R0008:Srgap2	UTSW	1	131355564	missense	probably damaging	0.99
R0016:Srgap2	UTSW	1	131349462	missense	possibly damaging	0.95
R0016:Srgap2	UTSW	1	131349462	missense	possibly damaging	0.95
R0044:Srgap2	UTSW	1	131319551	missense	possibly damaging	0.68
R0441:Srgap2	UTSW	1	131336437	missense	probably damaging	1.00
R0580:Srgap2	UTSW	1	131349501	missense	possibly damaging	0.81
R0882:Srgap2	UTSW	1	131289515	missense	probably benign	0.00
R1412:Srgap2	UTSW	1	131300413	missense	possibly damaging	0.81
R1501:Srgap2	UTSW	1	131292699	missense	probably damaging	1.00
R1740:Srgap2	UTSW	1	131289388	missense	probably benign	0.00
R1764:Srgap2	UTSW	1	131319537	missense	possibly damaging	0.94
R1772:Srgap2	UTSW	1	131319638	missense	probably damaging	0.99
R1776:Srgap2	UTSW	1	131411850	missense	probably damaging	1.00
R2393:Srgap2	UTSW	1	131332134	missense	probably benign	0.00
R3011:Srgap2	UTSW	1	131310591	missense	probably damaging	0.99
R3149:Srgap2	UTSW	1	131292589	missense	probably benign	0.00
R3150:Srgap2	UTSW	1	131292589	missense	probably benign	0.00
R3800:Srgap2	UTSW	1	131310559	missense	probably damaging	1.00
R4871:Srgap2	UTSW	1	131289472	missense	probably benign	0.00
R4884:Srgap2	UTSW	1	131292576	splice site	probably null
R5454:Srgap2	UTSW	1	131289737	missense	probably benign	0.08
R5536:Srgap2	UTSW	1	131300390	splice site	probably null
R6113:Srgap2	UTSW	1	131355505	splice site	probably null
R6174:Srgap2	UTSW	1	131289616	missense	probably benign	0.00
R6180:Srgap2	UTSW	1	131349541	missense	probably benign	0.00
R6341:Srgap2	UTSW	1	131291629	missense	probably benign	0.02
R6357:Srgap2	UTSW	1	131355542	missense	probably damaging	1.00
R6363:Srgap2	UTSW	1	131298468	missense	probably damaging	1.00
R6770:Srgap2	UTSW	1	131298510	missense	probably benign	0.00
R6934:Srgap2	UTSW	1	131317231	missense	possibly damaging	0.81
R7007:Srgap2	UTSW	1	131319537	missense	probably benign	0.15
R7077:Srgap2	UTSW	1	131344449	missense
R7147:Srgap2	UTSW	1	131310594	missense
R7326:Srgap2	UTSW	1	131291613	nonsense	probably null
R7467:Srgap2	UTSW	1	131292667	missense	probably damaging	0.97
R7500:Srgap2	UTSW	1	131436831	missense	probably damaging	1.00
R7579:Srgap2	UTSW	1	131292633	missense	probably damaging	0.99
R7923:Srgap2	UTSW	1	131300413	missense	possibly damaging	0.81
R7989:Srgap2	UTSW	1	131298432	missense
R8283:Srgap2	UTSW	1	131364033	missense	probably damaging	0.99
R8708:Srgap2	UTSW	1	131345806	nonsense	probably null
R8784:Srgap2	UTSW	1	131295474	missense	unknown
R8970:Srgap2	UTSW	1	131298366	missense
R9001:Srgap2	UTSW	1	131364060	missense	probably damaging	1.00
R9006:Srgap2	UTSW	1	131355569	missense	probably damaging	1.00
R9382:Srgap2	UTSW	1	131289608	missense	probably benign
R9599:Srgap2	UTSW	1	131344426	missense
R9616:Srgap2	UTSW	1	131325090	missense
X0022:Srgap2	UTSW	1	131411949	missense	probably benign	0.01
Z1177:Srgap2	UTSW	1	131355510	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGAACACGTGACCATGTTTC -3'
(R):5'- GCCTTCATCTCTCCCAGAACAG -3'

Sequencing Primer
(F):5'- CGTGACCATGTTTCTGAAACTAGGC -3'
(R):5'- TGACAGGTCATCAAGATGGCTCATC -3'

Posted On

2022-04-18