Mutagenetix > Incidental Mutation

Incidental Mutation 'R9389:Malrd1'

710464

Institutional Source

Beutler Lab

Gene Symbol

Malrd1

Ensembl Gene

ENSMUSG00000075520

Gene Name

MAM and LDL receptor class A domain containing 1

Synonyms

Diet1, Gm13364, Gm13318

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R9389 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

15526479-16255555 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 15703156 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 932 (N932I)

Ref Sequence

ENSEMBL: ENSMUSP00000116869 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000146205]

AlphaFold

A2AJX4

Predicted Effect

unknown
Transcript: ENSMUST00000146205
AA Change: N932I

SMART Domains

Protein: ENSMUSP00000116869
Gene: ENSMUSG00000075520
AA Change: N932I

Domain	Start	End	E-Value	Type
Pfam:MAM	8	171	1.6e-36	PFAM
LDLa	181	219	6.89e-8	SMART
LDLa	225	262	4.37e-10	SMART
LDLa	264	303	9.55e-3	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (55/55)

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	C	T	6: 41,033,145	G85D	probably benign	Het
4931440F15Rik	A	G	11: 29,825,107	S117P	probably damaging	Het
Abcb1b	G	A	5: 8,825,614	V596I	probably benign	Het
Agtpbp1	A	T	13: 59,466,070	M1019K	probably damaging	Het
Arfgef3	A	G	10: 18,603,523	V1448A	probably damaging	Het
Baz1a	T	A	12: 54,916,823	E828D	probably damaging	Het
Ces1f	A	T	8: 93,269,972		probably null	Het
Cfap53	T	A	18: 74,299,343		probably null	Het
Col6a4	T	C	9: 106,000,784	Y1998C	probably damaging	Het
Col9a2	A	G	4: 121,054,751	T675A	probably benign	Het
Dusp6	G	A	10: 99,263,977	V96M	possibly damaging	Het
Elmo1	T	G	13: 20,185,491	M22R	probably benign	Het
Gm19965	A	G	1: 116,821,836	N416D		Het
Gpr162	A	G	6: 124,861,394	Y98H	probably damaging	Het
Igfals	G	A	17: 24,881,626	V564I	probably benign	Het
Il4	C	T	11: 53,614,010	R76H	probably damaging	Het
Itgb1	T	A	8: 128,707,156	N50K	probably benign	Het
Itpr3	A	T	17: 27,095,925	Y682F	possibly damaging	Het
Jak3	C	T	8: 71,684,052	P668S	probably damaging	Het
Mast4	C	A	13: 103,333,930	R88L	probably benign	Het
Mfsd11	T	G	11: 116,873,335	S381A	probably benign	Het
Mrm3	A	G	11: 76,250,030	D288G	probably damaging	Het
Myg1	G	T	15: 102,336,937	V198F	probably damaging	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Npy6r	T	C	18: 44,275,692	I60T	probably damaging	Het
Olfr1109	A	T	2: 87,093,046	M117K	possibly damaging	Het
Olfr1308	G	T	2: 111,960,527	P182H	probably damaging	Het
Olfr1341	A	T	4: 118,710,156	M250L	probably benign	Het
Olfr177	C	T	16: 58,872,613	C179Y	probably damaging	Het
Olfr530	T	C	7: 140,373,017	T198A	probably benign	Het
Olfr811	G	A	10: 129,801,671	P285S	probably damaging	Het
Ovgp1	CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA	CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA	3: 105,986,525		probably benign	Het
Oxtr	C	A	6: 112,489,349	R150L	probably damaging	Het
Pappa	A	T	4: 65,180,888	Y548F	probably damaging	Het
Pip4k2a	T	C	2: 18,908,079	K73R	probably damaging	Het
Pla2g4f	T	A	2: 120,302,300	D685V	probably damaging	Het
Ppp1r35	T	A	5: 137,779,315	L81Q	probably damaging	Het
Ptprf	C	A	4: 118,236,039	A469S	probably benign	Het
Ranbp3l	T	A	15: 9,057,223	N322K	probably damaging	Het
Rev3l	T	A	10: 39,822,971	Y1155N	possibly damaging	Het
Rfesd	T	C	13: 76,003,012	Y96C	probably damaging	Het
Runx1	C	T	16: 92,613,680	V283I	possibly damaging	Het
Sema5b	A	C	16: 35,645,722	Q125P	probably damaging	Het
Spef2	A	T	15: 9,725,221	M150K	probably damaging	Het
Srcap	T	G	7: 127,542,283	L1745W	probably damaging	Het
Srgap2	A	G	1: 131,355,627	Y239H	probably damaging	Het
Svil	T	A	18: 5,090,811	H1304Q	possibly damaging	Het
Syne1	T	C	10: 5,229,193	D4427G	possibly damaging	Het
Tg	T	A	15: 66,689,324	M1065K	probably benign	Het
Tgm2	T	C	2: 158,117,896	T656A	probably benign	Het
Ttc37	A	G	13: 76,127,039	D403G	probably benign	Het
Ubr4	A	G	4: 139,425,924	K809E		Het
Vmn1r88	T	C	7: 13,178,619	S301P	probably damaging	Het
Wdr27	A	G	17: 14,891,718	V671A	possibly damaging	Het
Zbtb17	G	A	4: 141,465,820	V550I	possibly damaging	Het
Zeb2	A	T	2: 44,997,908	I379N	probably damaging	Het

Other mutations in Malrd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Malrd1	APN	2	16142186	splice site	probably benign
IGL01295:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01296:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01399:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01400:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01401:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01402:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01405:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01406:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL02105:Malrd1	APN	2	16127863	missense	unknown
IGL02581:Malrd1	APN	2	16142312	nonsense	probably null
IGL03015:Malrd1	APN	2	16042271	missense	unknown
IGL03038:Malrd1	APN	2	16127967	missense	unknown
R1353:Malrd1	UTSW	2	16127968	missense	unknown
R1385:Malrd1	UTSW	2	16042228	missense	unknown
R2242:Malrd1	UTSW	2	16101944	missense	unknown
R2888:Malrd1	UTSW	2	16074757	missense	unknown
R4398:Malrd1	UTSW	2	16150783	missense	unknown
R4982:Malrd1	UTSW	2	16042129	missense	probably benign	0.29
R5148:Malrd1	UTSW	2	16142226	missense	unknown
R5195:Malrd1	UTSW	2	16150810	missense	unknown
R5828:Malrd1	UTSW	2	15526653	missense	probably benign	0.00
R5892:Malrd1	UTSW	2	15614267	missense	probably benign	0.03
R6034:Malrd1	UTSW	2	15845326	missense	possibly damaging	0.78
R6034:Malrd1	UTSW	2	15845326	missense	possibly damaging	0.78
R6195:Malrd1	UTSW	2	15695326	missense	probably damaging	1.00
R6318:Malrd1	UTSW	2	16042267	missense	unknown
R6438:Malrd1	UTSW	2	15614206	missense
R6457:Malrd1	UTSW	2	15526597	start gained	probably benign
R6457:Malrd1	UTSW	2	15667929	missense	probably benign	0.41
R6499:Malrd1	UTSW	2	15931689	missense	probably benign	0.03
R6575:Malrd1	UTSW	2	15842628	missense	probably benign	0.00
R6792:Malrd1	UTSW	2	16150756	missense	unknown
R6796:Malrd1	UTSW	2	15869784	missense	unknown
R6930:Malrd1	UTSW	2	15797667	missense	unknown
R6959:Malrd1	UTSW	2	16218009	missense	probably damaging	0.97
R6993:Malrd1	UTSW	2	16150791	missense	unknown
R7102:Malrd1	UTSW	2	16142303	missense	unknown
R7112:Malrd1	UTSW	2	15925176	missense	unknown
R7248:Malrd1	UTSW	2	16101911	missense	unknown
R7249:Malrd1	UTSW	2	15623340	missense	probably damaging	0.97
R7334:Malrd1	UTSW	2	16006718	missense	probably damaging	0.99
R7394:Malrd1	UTSW	2	15695199	missense	unknown
R7399:Malrd1	UTSW	2	15610090	missense
R7476:Malrd1	UTSW	2	16142304	missense	unknown
R7582:Malrd1	UTSW	2	15695270	missense	unknown
R7604:Malrd1	UTSW	2	15925192	missense	unknown
R7662:Malrd1	UTSW	2	15871454	missense	unknown
R7681:Malrd1	UTSW	2	16218102	missense	unknown
R7740:Malrd1	UTSW	2	15614215	missense	not run
R7747:Malrd1	UTSW	2	16074835	missense	unknown
R7754:Malrd1	UTSW	2	15797799	splice site	probably null
R7950:Malrd1	UTSW	2	16128068	missense	unknown
R8194:Malrd1	UTSW	2	15925120	missense	unknown
R8260:Malrd1	UTSW	2	15614206	missense
R8314:Malrd1	UTSW	2	15752832	missense	unknown
R8342:Malrd1	UTSW	2	15633224	missense	unknown
R8386:Malrd1	UTSW	2	15696844	missense	unknown
R8492:Malrd1	UTSW	2	15610123	missense
R8728:Malrd1	UTSW	2	15696942	nonsense	probably null
R8756:Malrd1	UTSW	2	15752895	critical splice donor site	probably null
R8869:Malrd1	UTSW	2	15565557	critical splice donor site	probably null
R8888:Malrd1	UTSW	2	15845227	missense	unknown
R8895:Malrd1	UTSW	2	15845227	missense	unknown
R8902:Malrd1	UTSW	2	16255334	nonsense	probably null
R8954:Malrd1	UTSW	2	15551367	missense
R8960:Malrd1	UTSW	2	15565430	nonsense	probably null
R9005:Malrd1	UTSW	2	15845329	missense	unknown
R9135:Malrd1	UTSW	2	15797705	missense	unknown
R9267:Malrd1	UTSW	2	16255266	missense	unknown
R9330:Malrd1	UTSW	2	16255278	missense	unknown
R9359:Malrd1	UTSW	2	15614177	missense
R9383:Malrd1	UTSW	2	15695201	missense	unknown
R9403:Malrd1	UTSW	2	15614177	missense
R9454:Malrd1	UTSW	2	15752849	missense	unknown
R9454:Malrd1	UTSW	2	15797726	nonsense	probably null
R9520:Malrd1	UTSW	2	16074820	missense	unknown
R9544:Malrd1	UTSW	2	15635998	missense	unknown
R9609:Malrd1	UTSW	2	15695270	missense	unknown
R9667:Malrd1	UTSW	2	15565215	critical splice acceptor site	probably null
R9721:Malrd1	UTSW	2	15696827	missense	unknown
R9787:Malrd1	UTSW	2	15620590	missense	unknown
R9800:Malrd1	UTSW	2	15842594	missense	unknown
Z1176:Malrd1	UTSW	2	16217845	missense	unknown
Z1191:Malrd1	UTSW	2	16042226	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GGGTCCTACTTCAACGATGAACAC -3'
(R):5'- ATGCCACGATGTTTCACACTG -3'

Sequencing Primer
(F):5'- CGATGAACACAGGCCCAATG -3'
(R):5'- GCCACGATGTTTCACACTGCTAAG -3'

Posted On

2022-04-18