Incidental Mutation 'R9389:Pip4k2a'
ID 710465
Institutional Source Beutler Lab
Gene Symbol Pip4k2a
Ensembl Gene ENSMUSG00000026737
Gene Name phosphatidylinositol-5-phosphate 4-kinase, type II, alpha
Synonyms Pip5k2a
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9389 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 18847066-19002937 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18912890 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 73 (K73R)
Ref Sequence ENSEMBL: ENSMUSP00000006912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006912]
AlphaFold O70172
Predicted Effect probably damaging
Transcript: ENSMUST00000006912
AA Change: K73R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006912
Gene: ENSMUSG00000026737
AA Change: K73R

DomainStartEndE-ValueType
PIPKc 62 405 1.19e-169 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152981
SMART Domains Protein: ENSMUSP00000119075
Gene: ENSMUSG00000026737

DomainStartEndE-ValueType
Pfam:PIP5K 18 198 1.4e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol-5,4-bisphosphate, the precursor to second messengers of the phosphoinositide signal transduction pathways, is thought to be involved in the regulation of secretion, cell proliferation, differentiation, and motility. The protein encoded by this gene is one of a family of enzymes capable of catalyzing the phosphorylation of phosphatidylinositol-5-phosphate on the fourth hydroxyl of the myo-inositol ring to form phosphatidylinositol-5,4-bisphosphate. The amino acid sequence of this enzyme does not show homology to other kinases, but the recombinant protein does exhibit kinase activity. This gene is a member of the phosphatidylinositol-5-phosphate 4-kinase family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable and appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,875,614 (GRCm39) V596I probably benign Het
Agtpbp1 A T 13: 59,613,884 (GRCm39) M1019K probably damaging Het
Arfgef3 A G 10: 18,479,271 (GRCm39) V1448A probably damaging Het
Baz1a T A 12: 54,963,608 (GRCm39) E828D probably damaging Het
Ces1f A T 8: 93,996,600 (GRCm39) probably null Het
Cfap53 T A 18: 74,432,414 (GRCm39) probably null Het
Col6a4 T C 9: 105,877,983 (GRCm39) Y1998C probably damaging Het
Col9a2 A G 4: 120,911,948 (GRCm39) T675A probably benign Het
Dusp6 G A 10: 99,099,839 (GRCm39) V96M possibly damaging Het
Elmo1 T G 13: 20,369,661 (GRCm39) M22R probably benign Het
Fem1al A G 11: 29,775,107 (GRCm39) S117P probably damaging Het
Gm19965 A G 1: 116,749,566 (GRCm39) N416D Het
Gpr162 A G 6: 124,838,357 (GRCm39) Y98H probably damaging Het
Igfals G A 17: 25,100,600 (GRCm39) V564I probably benign Het
Il4 C T 11: 53,504,837 (GRCm39) R76H probably damaging Het
Itgb1 T A 8: 129,433,637 (GRCm39) N50K probably benign Het
Itpr3 A T 17: 27,314,899 (GRCm39) Y682F possibly damaging Het
Jak3 C T 8: 72,136,696 (GRCm39) P668S probably damaging Het
Malrd1 A T 2: 15,707,967 (GRCm39) N932I unknown Het
Mast4 C A 13: 103,470,438 (GRCm39) R88L probably benign Het
Mfsd11 T G 11: 116,764,161 (GRCm39) S381A probably benign Het
Mrm3 A G 11: 76,140,856 (GRCm39) D288G probably damaging Het
Myg1 G T 15: 102,245,372 (GRCm39) V198F probably damaging Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Npy6r T C 18: 44,408,759 (GRCm39) I60T probably damaging Het
Or12j3 T C 7: 139,952,930 (GRCm39) T198A probably benign Het
Or13p3 A T 4: 118,567,353 (GRCm39) M250L probably benign Het
Or4f57 G T 2: 111,790,872 (GRCm39) P182H probably damaging Het
Or5aq6 A T 2: 86,923,390 (GRCm39) M117K possibly damaging Het
Or5k14 C T 16: 58,692,976 (GRCm39) C179Y probably damaging Het
Or6c215 G A 10: 129,637,540 (GRCm39) P285S probably damaging Het
Ovgp1 CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA 3: 105,893,841 (GRCm39) probably benign Het
Oxtr C A 6: 112,466,310 (GRCm39) R150L probably damaging Het
Pappa A T 4: 65,099,125 (GRCm39) Y548F probably damaging Het
Pla2g4f T A 2: 120,132,781 (GRCm39) D685V probably damaging Het
Ppp1r35 T A 5: 137,777,577 (GRCm39) L81Q probably damaging Het
Prss3b C T 6: 41,010,079 (GRCm39) G85D probably benign Het
Ptprf C A 4: 118,093,236 (GRCm39) A469S probably benign Het
Ranbp3l T A 15: 9,057,304 (GRCm39) N322K probably damaging Het
Rev3l T A 10: 39,698,967 (GRCm39) Y1155N possibly damaging Het
Rfesd T C 13: 76,151,131 (GRCm39) Y96C probably damaging Het
Runx1 C T 16: 92,410,568 (GRCm39) V283I possibly damaging Het
Sema5b A C 16: 35,466,092 (GRCm39) Q125P probably damaging Het
Skic3 A G 13: 76,275,158 (GRCm39) D403G probably benign Het
Spef2 A T 15: 9,725,307 (GRCm39) M150K probably damaging Het
Srcap T G 7: 127,141,455 (GRCm39) L1745W probably damaging Het
Srgap2 A G 1: 131,283,365 (GRCm39) Y239H probably damaging Het
Svil T A 18: 5,090,811 (GRCm39) H1304Q possibly damaging Het
Syne1 T C 10: 5,179,193 (GRCm39) D4427G possibly damaging Het
Tg T A 15: 66,561,173 (GRCm39) M1065K probably benign Het
Tgm2 T C 2: 157,959,816 (GRCm39) T656A probably benign Het
Ubr4 A G 4: 139,153,235 (GRCm39) K809E Het
Vmn1r88 T C 7: 12,912,546 (GRCm39) S301P probably damaging Het
Wdr27 A G 17: 15,111,980 (GRCm39) V671A possibly damaging Het
Zbtb17 G A 4: 141,193,131 (GRCm39) V550I possibly damaging Het
Zeb2 A T 2: 44,887,920 (GRCm39) I379N probably damaging Het
Other mutations in Pip4k2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Pip4k2a APN 2 18,877,147 (GRCm39) missense probably benign 0.10
IGL01682:Pip4k2a APN 2 19,002,779 (GRCm39) missense probably benign
IGL02379:Pip4k2a APN 2 18,870,922 (GRCm39) critical splice donor site probably null
R0096:Pip4k2a UTSW 2 18,893,850 (GRCm39) splice site probably benign
R0184:Pip4k2a UTSW 2 18,893,939 (GRCm39) missense probably damaging 0.96
R0514:Pip4k2a UTSW 2 18,850,747 (GRCm39) missense probably damaging 0.99
R1673:Pip4k2a UTSW 2 18,877,093 (GRCm39) critical splice donor site probably null
R1779:Pip4k2a UTSW 2 18,852,433 (GRCm39) missense probably benign 0.27
R2198:Pip4k2a UTSW 2 18,852,466 (GRCm39) missense probably damaging 0.98
R4555:Pip4k2a UTSW 2 18,877,103 (GRCm39) missense probably damaging 0.99
R5408:Pip4k2a UTSW 2 18,911,119 (GRCm39) missense probably benign 0.03
R7598:Pip4k2a UTSW 2 18,877,098 (GRCm39) missense possibly damaging 0.50
R8971:Pip4k2a UTSW 2 18,852,367 (GRCm39) missense probably benign 0.00
R9000:Pip4k2a UTSW 2 18,877,240 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TCATAGGGAACAATATGCCATATGG -3'
(R):5'- CAGAGGAAAGGCACAGTTCC -3'

Sequencing Primer
(F):5'- ACTGCTGCTCTCTGAATGTGACAG -3'
(R):5'- GGAAAGGCACAGTTCCTGTTCTC -3'
Posted On 2022-04-18