Incidental Mutation 'R9389:Olfr1308'
ID 710468
Institutional Source Beutler Lab
Gene Symbol Olfr1308
Ensembl Gene ENSMUSG00000074952
Gene Name olfactory receptor 1308
Synonyms MOR245-22, GA_x6K02T2Q125-73008844-73007882
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R9389 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 111959285-111964944 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 111960527 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Histidine at position 182 (P182H)
Ref Sequence ENSEMBL: ENSMUSP00000146688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099605] [ENSMUST00000207560]
AlphaFold Q7TQX0
Predicted Effect probably damaging
Transcript: ENSMUST00000099605
AA Change: P182H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097200
Gene: ENSMUSG00000074952
AA Change: P182H

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 2.2e-39 PFAM
Pfam:7tm_1 41 287 3.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207560
AA Change: P182H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik C T 6: 41,033,145 G85D probably benign Het
4931440F15Rik A G 11: 29,825,107 S117P probably damaging Het
Abcb1b G A 5: 8,825,614 V596I probably benign Het
Agtpbp1 A T 13: 59,466,070 M1019K probably damaging Het
Arfgef3 A G 10: 18,603,523 V1448A probably damaging Het
Baz1a T A 12: 54,916,823 E828D probably damaging Het
Ces1f A T 8: 93,269,972 probably null Het
Cfap53 T A 18: 74,299,343 probably null Het
Col6a4 T C 9: 106,000,784 Y1998C probably damaging Het
Col9a2 A G 4: 121,054,751 T675A probably benign Het
Dusp6 G A 10: 99,263,977 V96M possibly damaging Het
Elmo1 T G 13: 20,185,491 M22R probably benign Het
Gm19965 A G 1: 116,821,836 N416D Het
Gpr162 A G 6: 124,861,394 Y98H probably damaging Het
Igfals G A 17: 24,881,626 V564I probably benign Het
Il4 C T 11: 53,614,010 R76H probably damaging Het
Itgb1 T A 8: 128,707,156 N50K probably benign Het
Itpr3 A T 17: 27,095,925 Y682F possibly damaging Het
Jak3 C T 8: 71,684,052 P668S probably damaging Het
Malrd1 A T 2: 15,703,156 N932I unknown Het
Mast4 C A 13: 103,333,930 R88L probably benign Het
Mfsd11 T G 11: 116,873,335 S381A probably benign Het
Mrm3 A G 11: 76,250,030 D288G probably damaging Het
Myg1 G T 15: 102,336,937 V198F probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Npy6r T C 18: 44,275,692 I60T probably damaging Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr1341 A T 4: 118,710,156 M250L probably benign Het
Olfr177 C T 16: 58,872,613 C179Y probably damaging Het
Olfr530 T C 7: 140,373,017 T198A probably benign Het
Olfr811 G A 10: 129,801,671 P285S probably damaging Het
Ovgp1 CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA 3: 105,986,525 probably benign Het
Oxtr C A 6: 112,489,349 R150L probably damaging Het
Pappa A T 4: 65,180,888 Y548F probably damaging Het
Pip4k2a T C 2: 18,908,079 K73R probably damaging Het
Pla2g4f T A 2: 120,302,300 D685V probably damaging Het
Ppp1r35 T A 5: 137,779,315 L81Q probably damaging Het
Ptprf C A 4: 118,236,039 A469S probably benign Het
Ranbp3l T A 15: 9,057,223 N322K probably damaging Het
Rev3l T A 10: 39,822,971 Y1155N possibly damaging Het
Rfesd T C 13: 76,003,012 Y96C probably damaging Het
Runx1 C T 16: 92,613,680 V283I possibly damaging Het
Sema5b A C 16: 35,645,722 Q125P probably damaging Het
Spef2 A T 15: 9,725,221 M150K probably damaging Het
Srcap T G 7: 127,542,283 L1745W probably damaging Het
Srgap2 A G 1: 131,355,627 Y239H probably damaging Het
Svil T A 18: 5,090,811 H1304Q possibly damaging Het
Syne1 T C 10: 5,229,193 D4427G possibly damaging Het
Tg T A 15: 66,689,324 M1065K probably benign Het
Tgm2 T C 2: 158,117,896 T656A probably benign Het
Ttc37 A G 13: 76,127,039 D403G probably benign Het
Ubr4 A G 4: 139,425,924 K809E Het
Vmn1r88 T C 7: 13,178,619 S301P probably damaging Het
Wdr27 A G 17: 14,891,718 V671A possibly damaging Het
Zbtb17 G A 4: 141,465,820 V550I possibly damaging Het
Zeb2 A T 2: 44,997,908 I379N probably damaging Het
Other mutations in Olfr1308
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Olfr1308 APN 2 111960275 missense possibly damaging 0.84
IGL01359:Olfr1308 APN 2 111961061 missense probably benign
IGL01731:Olfr1308 APN 2 111960635 missense probably benign 0.03
IGL01788:Olfr1308 APN 2 111961007 missense probably benign
IGL02385:Olfr1308 APN 2 111960258 missense probably benign 0.00
IGL02969:Olfr1308 APN 2 111960567 missense probably damaging 1.00
R0102:Olfr1308 UTSW 2 111960597 missense probably damaging 1.00
R0102:Olfr1308 UTSW 2 111960597 missense probably damaging 1.00
R0244:Olfr1308 UTSW 2 111961016 missense probably benign 0.13
R0265:Olfr1308 UTSW 2 111960494 missense probably damaging 0.99
R1268:Olfr1308 UTSW 2 111960877 missense possibly damaging 0.78
R1406:Olfr1308 UTSW 2 111960581 missense probably benign 0.07
R1406:Olfr1308 UTSW 2 111960581 missense probably benign 0.07
R1568:Olfr1308 UTSW 2 111960240 missense probably benign 0.02
R2401:Olfr1308 UTSW 2 111960149 missense probably benign 0.01
R4396:Olfr1308 UTSW 2 111960215 missense probably damaging 1.00
R4528:Olfr1308 UTSW 2 111960948 missense probably damaging 1.00
R5916:Olfr1308 UTSW 2 111960830 missense probably damaging 1.00
R6332:Olfr1308 UTSW 2 111960746 missense probably damaging 0.98
R6595:Olfr1308 UTSW 2 111960170 missense possibly damaging 0.95
R7339:Olfr1308 UTSW 2 111960611 missense probably benign 0.12
R7917:Olfr1308 UTSW 2 111960965 missense probably damaging 0.98
R8017:Olfr1308 UTSW 2 111960573 missense probably damaging 0.99
R8092:Olfr1308 UTSW 2 111960307 missense probably benign 0.00
R8246:Olfr1308 UTSW 2 111960138 missense probably benign 0.05
R9515:Olfr1308 UTSW 2 111960239 missense possibly damaging 0.54
R9631:Olfr1308 UTSW 2 111961032 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CCACCATAACATGAGCTGAAAGTG -3'
(R):5'- GGTTTTACTCATAGCCATGGCC -3'

Sequencing Primer
(F):5'- CTGAAAGTGTAGACAAAGCCTTG -3'
(R):5'- ATAGCCATGGCCTTTGACAG -3'
Posted On 2022-04-18