Mutagenetix > Incidental Mutation

Incidental Mutation 'R9389:Tgm2'

710470

Institutional Source

Beutler Lab

Gene Symbol

Tgm2

Ensembl Gene

ENSMUSG00000037820

Gene Name

transglutaminase 2, C polypeptide

Synonyms

tTG, protein-glutamine gamma-glutamyltransferase, TGase2, TG2, TG C, G[a]h, tTGas, tissue transglutaminase

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.171) question?

Stock #

R9389 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

158116402-158146436 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 158117896 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 656 (T656A)

Ref Sequence

ENSEMBL: ENSMUSP00000099411 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103122] [ENSMUST00000152452]

AlphaFold

P21981

Predicted Effect

probably benign
Transcript: ENSMUST00000103122
AA Change: T656A

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000099411
Gene: ENSMUSG00000037820
AA Change: T656A

Domain	Start	End	E-Value	Type
Pfam:Transglut_N	6	122	3.6e-34	PFAM
TGc	269	361	1.11e-38	SMART
Pfam:Transglut_C	473	572	5.7e-29	PFAM
Pfam:Transglut_C	586	685	2.4e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000152452

SMART Domains

Protein: ENSMUSP00000118434
Gene: ENSMUSG00000027651

Domain	Start	End	E-Value	Type
RPR	8	130	1.71e-53	SMART
low complexity region	132	145	N/A	INTRINSIC
PDB:4FLA\|D	171	222	3e-25	PDB

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene acts as a monomer, is induced by retinoic acid, and appears to be involved in apoptosis. Finally, the encoded protein is the autoantigen implicated in celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: A homozygous null mutation causes alterations in glucose and aerobic energy metabolism, tumor growth, and response to myocardial infarction, liver injury, and LPS-induced sepsis. A second null mutation confers resistance to renal injury, while a third one alters cell adhesion and T cell physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	C	T	6: 41,033,145	G85D	probably benign	Het
4931440F15Rik	A	G	11: 29,825,107	S117P	probably damaging	Het
Abcb1b	G	A	5: 8,825,614	V596I	probably benign	Het
Agtpbp1	A	T	13: 59,466,070	M1019K	probably damaging	Het
Arfgef3	A	G	10: 18,603,523	V1448A	probably damaging	Het
Baz1a	T	A	12: 54,916,823	E828D	probably damaging	Het
Ces1f	A	T	8: 93,269,972		probably null	Het
Cfap53	T	A	18: 74,299,343		probably null	Het
Col6a4	T	C	9: 106,000,784	Y1998C	probably damaging	Het
Col9a2	A	G	4: 121,054,751	T675A	probably benign	Het
Dusp6	G	A	10: 99,263,977	V96M	possibly damaging	Het
Elmo1	T	G	13: 20,185,491	M22R	probably benign	Het
Gm19965	A	G	1: 116,821,836	N416D		Het
Gpr162	A	G	6: 124,861,394	Y98H	probably damaging	Het
Igfals	G	A	17: 24,881,626	V564I	probably benign	Het
Il4	C	T	11: 53,614,010	R76H	probably damaging	Het
Itgb1	T	A	8: 128,707,156	N50K	probably benign	Het
Itpr3	A	T	17: 27,095,925	Y682F	possibly damaging	Het
Jak3	C	T	8: 71,684,052	P668S	probably damaging	Het
Malrd1	A	T	2: 15,703,156	N932I	unknown	Het
Mast4	C	A	13: 103,333,930	R88L	probably benign	Het
Mfsd11	T	G	11: 116,873,335	S381A	probably benign	Het
Mrm3	A	G	11: 76,250,030	D288G	probably damaging	Het
Myg1	G	T	15: 102,336,937	V198F	probably damaging	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Npy6r	T	C	18: 44,275,692	I60T	probably damaging	Het
Olfr1109	A	T	2: 87,093,046	M117K	possibly damaging	Het
Olfr1308	G	T	2: 111,960,527	P182H	probably damaging	Het
Olfr1341	A	T	4: 118,710,156	M250L	probably benign	Het
Olfr177	C	T	16: 58,872,613	C179Y	probably damaging	Het
Olfr530	T	C	7: 140,373,017	T198A	probably benign	Het
Olfr811	G	A	10: 129,801,671	P285S	probably damaging	Het
Ovgp1	CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA	CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA	3: 105,986,525		probably benign	Het
Oxtr	C	A	6: 112,489,349	R150L	probably damaging	Het
Pappa	A	T	4: 65,180,888	Y548F	probably damaging	Het
Pip4k2a	T	C	2: 18,908,079	K73R	probably damaging	Het
Pla2g4f	T	A	2: 120,302,300	D685V	probably damaging	Het
Ppp1r35	T	A	5: 137,779,315	L81Q	probably damaging	Het
Ptprf	C	A	4: 118,236,039	A469S	probably benign	Het
Ranbp3l	T	A	15: 9,057,223	N322K	probably damaging	Het
Rev3l	T	A	10: 39,822,971	Y1155N	possibly damaging	Het
Rfesd	T	C	13: 76,003,012	Y96C	probably damaging	Het
Runx1	C	T	16: 92,613,680	V283I	possibly damaging	Het
Sema5b	A	C	16: 35,645,722	Q125P	probably damaging	Het
Spef2	A	T	15: 9,725,221	M150K	probably damaging	Het
Srcap	T	G	7: 127,542,283	L1745W	probably damaging	Het
Srgap2	A	G	1: 131,355,627	Y239H	probably damaging	Het
Svil	T	A	18: 5,090,811	H1304Q	possibly damaging	Het
Syne1	T	C	10: 5,229,193	D4427G	possibly damaging	Het
Tg	T	A	15: 66,689,324	M1065K	probably benign	Het
Ttc37	A	G	13: 76,127,039	D403G	probably benign	Het
Ubr4	A	G	4: 139,425,924	K809E		Het
Vmn1r88	T	C	7: 13,178,619	S301P	probably damaging	Het
Wdr27	A	G	17: 14,891,718	V671A	possibly damaging	Het
Zbtb17	G	A	4: 141,465,820	V550I	possibly damaging	Het
Zeb2	A	T	2: 44,997,908	I379N	probably damaging	Het

Other mutations in Tgm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01990:Tgm2	APN	2	158124131	missense	probably benign
IGL03110:Tgm2	APN	2	158131490	nonsense	probably null
IGL03397:Tgm2	APN	2	158120258	missense	probably damaging	1.00
R0595:Tgm2	UTSW	2	158143042	missense	probably damaging	1.00
R0786:Tgm2	UTSW	2	158124381	missense	probably damaging	1.00
R1019:Tgm2	UTSW	2	158124154	nonsense	probably null
R1395:Tgm2	UTSW	2	158124252	missense	probably benign	0.01
R1732:Tgm2	UTSW	2	158134357	missense	probably damaging	1.00
R1776:Tgm2	UTSW	2	158131459	missense	probably benign	0.00
R1863:Tgm2	UTSW	2	158124219	missense	probably damaging	1.00
R2863:Tgm2	UTSW	2	158143099	missense	probably benign	0.01
R3036:Tgm2	UTSW	2	158124247	missense	probably benign	0.00
R4200:Tgm2	UTSW	2	158132490	missense	probably benign
R4370:Tgm2	UTSW	2	158124301	nonsense	probably null
R4612:Tgm2	UTSW	2	158124204	missense	probably benign	0.16
R5100:Tgm2	UTSW	2	158127164	missense	probably benign	0.33
R5213:Tgm2	UTSW	2	158143060	missense	possibly damaging	0.88
R5253:Tgm2	UTSW	2	158129438	missense	probably damaging	1.00
R5585:Tgm2	UTSW	2	158131455	nonsense	probably null
R5593:Tgm2	UTSW	2	158127342	missense	probably damaging	1.00
R5616:Tgm2	UTSW	2	158128720	missense	probably damaging	1.00
R5796:Tgm2	UTSW	2	158118904	missense	probably benign	0.00
R5821:Tgm2	UTSW	2	158143054	missense	possibly damaging	0.81
R5842:Tgm2	UTSW	2	158143081	missense	probably damaging	1.00
R6317:Tgm2	UTSW	2	158124150	missense	probably benign	0.18
R6610:Tgm2	UTSW	2	158143100	nonsense	probably null
R7134:Tgm2	UTSW	2	158138892	missense	probably benign
R7151:Tgm2	UTSW	2	158129395	missense	possibly damaging	0.95
R7268:Tgm2	UTSW	2	158120268	nonsense	probably null
R7719:Tgm2	UTSW	2	158143118	missense	probably damaging	1.00
R8728:Tgm2	UTSW	2	158120145	missense	probably benign	0.02
R9460:Tgm2	UTSW	2	158129321	critical splice donor site	probably null
R9509:Tgm2	UTSW	2	158127290	nonsense	probably null
R9518:Tgm2	UTSW	2	158143129	missense	probably benign	0.03
R9781:Tgm2	UTSW	2	158129401	missense	probably damaging	1.00
X0058:Tgm2	UTSW	2	158124147	missense	probably benign	0.01
X0067:Tgm2	UTSW	2	158118845	critical splice donor site	probably null
Z1177:Tgm2	UTSW	2	158117899	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGGGGTGAAGTTGCTCATTATC -3'
(R):5'- GAAACCTAGCCCTGCAGAAG -3'

Sequencing Primer
(F):5'- TCTTAGGATAAAGACCAGGTTGAATG -3'
(R):5'- GAGTTGGATCCATTATCAACACTGGC -3'

Posted On

2022-04-18