Mutagenetix > Incidental Mutation

Incidental Mutation 'R9389:Pappa'

710472

Institutional Source

Beutler Lab

Gene Symbol

Pappa

Ensembl Gene

ENSMUSG00000028370

Gene Name

pregnancy-associated plasma protein A

Synonyms

IGFBP-4ase, PAPP-A, PAG1, 8430414N03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9389 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

65124174-65357509 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 65180888 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 548 (Y548F)

Ref Sequence

ENSEMBL: ENSMUSP00000081545 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084501]

AlphaFold

Q8R4K8

Predicted Effect

probably damaging
Transcript: ENSMUST00000084501
AA Change: Y548F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000081545
Gene: ENSMUSG00000028370
AA Change: Y548F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	24	66	N/A	INTRINSIC
low complexity region	69	87	N/A	INTRINSIC
LamGL	114	263	1.55e-54	SMART
NL	396	438	4.15e-8	SMART
NL	441	471	6.73e-1	SMART
Pfam:Peptidase_M43	500	657	2.5e-10	PFAM
Blast:FN3	669	929	1e-165	BLAST
CCP	1212	1277	1.39e-9	SMART
CCP	1282	1339	1.08e-6	SMART
CCP	1343	1407	1.64e-6	SMART
CCP	1412	1468	8.06e-6	SMART
NL	1544	1581	3.24e-10	SMART
low complexity region	1584	1591	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted metalloproteinase which cleaves insulin-like growth factor binding proteins (IGFBPs). It is thought to be involved in local proliferative processes such as wound healing and bone remodeling. Low plasma level of this protein has been suggested as a biochemical marker for pregnancies with aneuploid fetuses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are smaller than normal with delayed ossification, but are otherwise normal and fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	C	T	6: 41,033,145	G85D	probably benign	Het
4931440F15Rik	A	G	11: 29,825,107	S117P	probably damaging	Het
Abcb1b	G	A	5: 8,825,614	V596I	probably benign	Het
Agtpbp1	A	T	13: 59,466,070	M1019K	probably damaging	Het
Arfgef3	A	G	10: 18,603,523	V1448A	probably damaging	Het
Baz1a	T	A	12: 54,916,823	E828D	probably damaging	Het
Ces1f	A	T	8: 93,269,972		probably null	Het
Cfap53	T	A	18: 74,299,343		probably null	Het
Col6a4	T	C	9: 106,000,784	Y1998C	probably damaging	Het
Col9a2	A	G	4: 121,054,751	T675A	probably benign	Het
Dusp6	G	A	10: 99,263,977	V96M	possibly damaging	Het
Elmo1	T	G	13: 20,185,491	M22R	probably benign	Het
Gm19965	A	G	1: 116,821,836	N416D		Het
Gpr162	A	G	6: 124,861,394	Y98H	probably damaging	Het
Igfals	G	A	17: 24,881,626	V564I	probably benign	Het
Il4	C	T	11: 53,614,010	R76H	probably damaging	Het
Itgb1	T	A	8: 128,707,156	N50K	probably benign	Het
Itpr3	A	T	17: 27,095,925	Y682F	possibly damaging	Het
Jak3	C	T	8: 71,684,052	P668S	probably damaging	Het
Malrd1	A	T	2: 15,703,156	N932I	unknown	Het
Mast4	C	A	13: 103,333,930	R88L	probably benign	Het
Mfsd11	T	G	11: 116,873,335	S381A	probably benign	Het
Mrm3	A	G	11: 76,250,030	D288G	probably damaging	Het
Myg1	G	T	15: 102,336,937	V198F	probably damaging	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Npy6r	T	C	18: 44,275,692	I60T	probably damaging	Het
Olfr1109	A	T	2: 87,093,046	M117K	possibly damaging	Het
Olfr1308	G	T	2: 111,960,527	P182H	probably damaging	Het
Olfr1341	A	T	4: 118,710,156	M250L	probably benign	Het
Olfr177	C	T	16: 58,872,613	C179Y	probably damaging	Het
Olfr530	T	C	7: 140,373,017	T198A	probably benign	Het
Olfr811	G	A	10: 129,801,671	P285S	probably damaging	Het
Ovgp1	CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA	CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA	3: 105,986,525		probably benign	Het
Oxtr	C	A	6: 112,489,349	R150L	probably damaging	Het
Pip4k2a	T	C	2: 18,908,079	K73R	probably damaging	Het
Pla2g4f	T	A	2: 120,302,300	D685V	probably damaging	Het
Ppp1r35	T	A	5: 137,779,315	L81Q	probably damaging	Het
Ptprf	C	A	4: 118,236,039	A469S	probably benign	Het
Ranbp3l	T	A	15: 9,057,223	N322K	probably damaging	Het
Rev3l	T	A	10: 39,822,971	Y1155N	possibly damaging	Het
Rfesd	T	C	13: 76,003,012	Y96C	probably damaging	Het
Runx1	C	T	16: 92,613,680	V283I	possibly damaging	Het
Sema5b	A	C	16: 35,645,722	Q125P	probably damaging	Het
Spef2	A	T	15: 9,725,221	M150K	probably damaging	Het
Srcap	T	G	7: 127,542,283	L1745W	probably damaging	Het
Srgap2	A	G	1: 131,355,627	Y239H	probably damaging	Het
Svil	T	A	18: 5,090,811	H1304Q	possibly damaging	Het
Syne1	T	C	10: 5,229,193	D4427G	possibly damaging	Het
Tg	T	A	15: 66,689,324	M1065K	probably benign	Het
Tgm2	T	C	2: 158,117,896	T656A	probably benign	Het
Ttc37	A	G	13: 76,127,039	D403G	probably benign	Het
Ubr4	A	G	4: 139,425,924	K809E		Het
Vmn1r88	T	C	7: 13,178,619	S301P	probably damaging	Het
Wdr27	A	G	17: 14,891,718	V671A	possibly damaging	Het
Zbtb17	G	A	4: 141,465,820	V550I	possibly damaging	Het
Zeb2	A	T	2: 44,997,908	I379N	probably damaging	Het

Other mutations in Pappa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01096:Pappa	APN	4	65189316	missense	probably damaging	1.00
IGL01340:Pappa	APN	4	65323872	missense	possibly damaging	0.49
IGL01482:Pappa	APN	4	65156034	missense	probably benign	0.18
IGL01485:Pappa	APN	4	65189299	missense	probably damaging	0.96
IGL01759:Pappa	APN	4	65205158	splice site	probably null
IGL01860:Pappa	APN	4	65205092	missense	possibly damaging	0.50
IGL01990:Pappa	APN	4	65156687	splice site	probably benign
IGL02089:Pappa	APN	4	65156124	missense	possibly damaging	0.75
IGL02153:Pappa	APN	4	65297437	missense	probably damaging	0.96
IGL02184:Pappa	APN	4	65340691	missense	possibly damaging	0.82
IGL02324:Pappa	APN	4	65196808	missense	probably damaging	0.99
IGL02542:Pappa	APN	4	65176281	missense	probably damaging	1.00
IGL02556:Pappa	APN	4	65156626	missense	possibly damaging	0.56
IGL02698:Pappa	APN	4	65181020	missense	probably damaging	1.00
IGL02903:Pappa	APN	4	65261980	missense	probably damaging	1.00
IGL02974:Pappa	APN	4	65204935	missense	probably damaging	1.00
IGL03107:Pappa	APN	4	65204703	missense	probably damaging	1.00
IGL03376:Pappa	APN	4	65196834	missense	probably benign	0.01
caer	UTSW	4	65124891	missense	probably damaging	0.98
Maennel	UTSW	4	65314587	missense	probably benign	0.05
maennelein	UTSW	4	65314796	splice site	probably null
mama	UTSW	4	65204867	missense	possibly damaging	0.94
Revisitation	UTSW	4	65294468	missense	probably damaging	0.96
Sesquester	UTSW	4	65156375	missense	possibly damaging	0.66
untersuchen	UTSW	4	65297257	missense	probably damaging	1.00
IGL02980:Pappa	UTSW	4	65307774	missense	probably benign	0.25
PIT4498001:Pappa	UTSW	4	65316232	missense	probably damaging	1.00
R0077:Pappa	UTSW	4	65307812	missense	probably damaging	1.00
R0390:Pappa	UTSW	4	65351613	splice site	probably null
R0458:Pappa	UTSW	4	65155882	missense	probably damaging	1.00
R0883:Pappa	UTSW	4	65189315	nonsense	probably null
R0946:Pappa	UTSW	4	65314792	critical splice donor site	probably null
R1228:Pappa	UTSW	4	65340689	missense	probably damaging	1.00
R1327:Pappa	UTSW	4	65351603	splice site	probably benign
R1489:Pappa	UTSW	4	65180948	missense	possibly damaging	0.85
R1619:Pappa	UTSW	4	65176229	missense	probably damaging	1.00
R1856:Pappa	UTSW	4	65340743	missense	probably damaging	1.00
R2047:Pappa	UTSW	4	65231141	splice site	probably benign
R2102:Pappa	UTSW	4	65316228	nonsense	probably null
R2127:Pappa	UTSW	4	65297257	missense	probably damaging	1.00
R2143:Pappa	UTSW	4	65180949	nonsense	probably null
R2144:Pappa	UTSW	4	65180949	nonsense	probably null
R2166:Pappa	UTSW	4	65156445	missense	probably damaging	1.00
R2167:Pappa	UTSW	4	65156445	missense	probably damaging	1.00
R2168:Pappa	UTSW	4	65156445	missense	probably damaging	1.00
R2178:Pappa	UTSW	4	65351687	missense	probably benign	0.00
R2504:Pappa	UTSW	4	65180889	nonsense	probably null
R4043:Pappa	UTSW	4	65314587	missense	probably benign	0.05
R4289:Pappa	UTSW	4	65155863	missense	probably benign	0.19
R4415:Pappa	UTSW	4	65305295	missense	probably benign	0.00
R4529:Pappa	UTSW	4	65231182	missense	probably benign
R4620:Pappa	UTSW	4	65327028	missense	probably benign	0.43
R4657:Pappa	UTSW	4	65314796	splice site	probably null
R4658:Pappa	UTSW	4	65314796	splice site	probably null
R5074:Pappa	UTSW	4	65205128	missense	probably benign	0.15
R5200:Pappa	UTSW	4	65155839	missense	probably damaging	1.00
R5420:Pappa	UTSW	4	65335780	critical splice donor site	probably null
R5469:Pappa	UTSW	4	65205152	missense	probably benign	0.01
R5651:Pappa	UTSW	4	65156352	missense	probably damaging	0.99
R5725:Pappa	UTSW	4	65189410	missense	probably damaging	1.00
R5941:Pappa	UTSW	4	65314593	missense	possibly damaging	0.52
R6002:Pappa	UTSW	4	65297408	missense	probably damaging	0.99
R6252:Pappa	UTSW	4	65189412	missense	probably benign	0.02
R6303:Pappa	UTSW	4	65204654	missense	probably damaging	1.00
R6322:Pappa	UTSW	4	65314659	missense	probably damaging	1.00
R6431:Pappa	UTSW	4	65156464	missense	probably damaging	1.00
R6462:Pappa	UTSW	4	65124891	missense	probably damaging	0.98
R6484:Pappa	UTSW	4	65314659	missense	probably damaging	1.00
R6537:Pappa	UTSW	4	65297282	missense	probably damaging	0.99
R6578:Pappa	UTSW	4	65156137	missense	possibly damaging	0.48
R6704:Pappa	UTSW	4	65204924	missense	probably damaging	1.00
R6789:Pappa	UTSW	4	65181041	missense	probably damaging	1.00
R7023:Pappa	UTSW	4	65351718	missense	probably benign	0.00
R7139:Pappa	UTSW	4	65189450	missense	probably benign	0.30
R7158:Pappa	UTSW	4	65204867	missense	possibly damaging	0.94
R7165:Pappa	UTSW	4	65261873	missense	probably damaging	1.00
R7196:Pappa	UTSW	4	65323891	splice site	probably null
R7410:Pappa	UTSW	4	65335719	missense	probably damaging	1.00
R7457:Pappa	UTSW	4	65189266	missense	probably damaging	1.00
R7506:Pappa	UTSW	4	65231182	missense	probably benign	0.00
R7546:Pappa	UTSW	4	65156115	missense	possibly damaging	0.48
R7975:Pappa	UTSW	4	65294468	missense	probably damaging	0.96
R8111:Pappa	UTSW	4	65261992	missense	probably damaging	0.99
R8260:Pappa	UTSW	4	65316182	missense	probably damaging	0.99
R8347:Pappa	UTSW	4	65327065	missense	probably damaging	1.00
R8520:Pappa	UTSW	4	65335764	missense	probably benign	0.01
R8812:Pappa	UTSW	4	65204929	missense	possibly damaging	0.94
R8815:Pappa	UTSW	4	65181110	missense	probably benign	0.00
R9008:Pappa	UTSW	4	65156189	missense	probably damaging	1.00
R9162:Pappa	UTSW	4	65204803	missense	probably damaging	1.00
R9170:Pappa	UTSW	4	65340725	missense	probably damaging	1.00
R9205:Pappa	UTSW	4	65156375	missense	possibly damaging	0.66
R9336:Pappa	UTSW	4	65124681	missense	unknown
R9781:Pappa	UTSW	4	65124867	missense	possibly damaging	0.89
RF006:Pappa	UTSW	4	65323873	missense	probably benign	0.00
RF020:Pappa	UTSW	4	65205045	missense	possibly damaging	0.77
X0058:Pappa	UTSW	4	65156232	missense	probably damaging	1.00
X0060:Pappa	UTSW	4	65124941	missense	probably benign	0.00
Z1177:Pappa	UTSW	4	65307758	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGAGTTCTGACAACCCAG -3'
(R):5'- TGAAAGCCACAAGTGTCATTCC -3'

Sequencing Primer
(F):5'- AGTTCTGACAACCCAGGAACTGTAG -3'
(R):5'- GTCCAGGGTCTCCACAAAACTTG -3'

Posted On

2022-04-18