Mutagenetix > Incidental Mutation

Incidental Mutation 'R9389:Ptprf'

710473

Institutional Source

Beutler Lab

Gene Symbol

Ptprf

Ensembl Gene

ENSMUSG00000033295

Gene Name

protein tyrosine phosphatase, receptor type, F

Synonyms

RPTP-LAR, LAR

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.711) question?

Stock #

R9389 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118208213-118291405 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 118236039 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 469 (A469S)

Ref Sequence

ENSEMBL: ENSMUSP00000039368 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049074] [ENSMUST00000222620]

AlphaFold

A2A8L5

PDB Structure

Tandem Ig domains of tyrosine phosphatase LAR [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000049074
AA Change: A469S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000039368
Gene: ENSMUSG00000033295
AA Change: A469S

Domain	Start	End	E-Value	Type
IGc2	45	114	2.64e-12	SMART
IGc2	147	214	1.48e-15	SMART
IG	238	316	1.06e-11	SMART
FN3	319	398	6.9e-14	SMART
FN3	414	497	5.73e-11	SMART
FN3	512	591	4.06e-11	SMART
FN3	606	693	8.69e-11	SMART
FN3	709	797	8.83e-12	SMART
FN3	812	892	3.2e-9	SMART
FN3	907	988	2.53e-12	SMART
FN3	1003	1079	3.48e-1	SMART
coiled coil region	1146	1175	N/A	INTRINSIC
transmembrane domain	1253	1275	N/A	INTRINSIC
PTPc	1342	1600	1.12e-138	SMART
PTPc	1629	1891	3.4e-129	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124758

SMART Domains

Protein: ENSMUSP00000119954
Gene: ENSMUSG00000033295

Domain	Start	End	E-Value	Type
FN3	37	116	4.06e-11	SMART
FN3	132	220	8.83e-12	SMART
FN3	235	315	3.2e-9	SMART
FN3	330	411	2.53e-12	SMART
FN3	426	502	3.48e-1	SMART
coiled coil region	568	597	N/A	INTRINSIC
transmembrane domain	676	698	N/A	INTRINSIC
PTPc	776	1034	1.12e-138	SMART
PTPc	1063	1325	3.4e-129	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000117313
Gene: ENSMUSG00000033295
AA Change: A136S

Domain	Start	End	E-Value	Type
FN3	14	66	2.7e1	SMART
FN3	82	165	5.73e-11	SMART
FN3	180	259	4.06e-11	SMART
FN3	275	372	6.69e-12	SMART
FN3	385	461	2.83e-1	SMART
coiled coil region	527	556	N/A	INTRINSIC
transmembrane domain	635	657	N/A	INTRINSIC
PTPc	735	993	1.12e-138	SMART
PTPc	1022	1284	3.4e-129	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000222620

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females have premature involution of the mammary glands leading to an inability to feed pups. Other characteristics of null mice include defective nerve regeneration and hyperactivity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	C	T	6: 41,033,145	G85D	probably benign	Het
4931440F15Rik	A	G	11: 29,825,107	S117P	probably damaging	Het
Abcb1b	G	A	5: 8,825,614	V596I	probably benign	Het
Agtpbp1	A	T	13: 59,466,070	M1019K	probably damaging	Het
Arfgef3	A	G	10: 18,603,523	V1448A	probably damaging	Het
Baz1a	T	A	12: 54,916,823	E828D	probably damaging	Het
Ces1f	A	T	8: 93,269,972		probably null	Het
Cfap53	T	A	18: 74,299,343		probably null	Het
Col6a4	T	C	9: 106,000,784	Y1998C	probably damaging	Het
Col9a2	A	G	4: 121,054,751	T675A	probably benign	Het
Dusp6	G	A	10: 99,263,977	V96M	possibly damaging	Het
Elmo1	T	G	13: 20,185,491	M22R	probably benign	Het
Gm19965	A	G	1: 116,821,836	N416D		Het
Gpr162	A	G	6: 124,861,394	Y98H	probably damaging	Het
Igfals	G	A	17: 24,881,626	V564I	probably benign	Het
Il4	C	T	11: 53,614,010	R76H	probably damaging	Het
Itgb1	T	A	8: 128,707,156	N50K	probably benign	Het
Itpr3	A	T	17: 27,095,925	Y682F	possibly damaging	Het
Jak3	C	T	8: 71,684,052	P668S	probably damaging	Het
Malrd1	A	T	2: 15,703,156	N932I	unknown	Het
Mast4	C	A	13: 103,333,930	R88L	probably benign	Het
Mfsd11	T	G	11: 116,873,335	S381A	probably benign	Het
Mrm3	A	G	11: 76,250,030	D288G	probably damaging	Het
Myg1	G	T	15: 102,336,937	V198F	probably damaging	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Npy6r	T	C	18: 44,275,692	I60T	probably damaging	Het
Olfr1109	A	T	2: 87,093,046	M117K	possibly damaging	Het
Olfr1308	G	T	2: 111,960,527	P182H	probably damaging	Het
Olfr1341	A	T	4: 118,710,156	M250L	probably benign	Het
Olfr177	C	T	16: 58,872,613	C179Y	probably damaging	Het
Olfr530	T	C	7: 140,373,017	T198A	probably benign	Het
Olfr811	G	A	10: 129,801,671	P285S	probably damaging	Het
Ovgp1	CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA	CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA	3: 105,986,525		probably benign	Het
Oxtr	C	A	6: 112,489,349	R150L	probably damaging	Het
Pappa	A	T	4: 65,180,888	Y548F	probably damaging	Het
Pip4k2a	T	C	2: 18,908,079	K73R	probably damaging	Het
Pla2g4f	T	A	2: 120,302,300	D685V	probably damaging	Het
Ppp1r35	T	A	5: 137,779,315	L81Q	probably damaging	Het
Ranbp3l	T	A	15: 9,057,223	N322K	probably damaging	Het
Rev3l	T	A	10: 39,822,971	Y1155N	possibly damaging	Het
Rfesd	T	C	13: 76,003,012	Y96C	probably damaging	Het
Runx1	C	T	16: 92,613,680	V283I	possibly damaging	Het
Sema5b	A	C	16: 35,645,722	Q125P	probably damaging	Het
Spef2	A	T	15: 9,725,221	M150K	probably damaging	Het
Srcap	T	G	7: 127,542,283	L1745W	probably damaging	Het
Srgap2	A	G	1: 131,355,627	Y239H	probably damaging	Het
Svil	T	A	18: 5,090,811	H1304Q	possibly damaging	Het
Syne1	T	C	10: 5,229,193	D4427G	possibly damaging	Het
Tg	T	A	15: 66,689,324	M1065K	probably benign	Het
Tgm2	T	C	2: 158,117,896	T656A	probably benign	Het
Ttc37	A	G	13: 76,127,039	D403G	probably benign	Het
Ubr4	A	G	4: 139,425,924	K809E		Het
Vmn1r88	T	C	7: 13,178,619	S301P	probably damaging	Het
Wdr27	A	G	17: 14,891,718	V671A	possibly damaging	Het
Zbtb17	G	A	4: 141,465,820	V550I	possibly damaging	Het
Zeb2	A	T	2: 44,997,908	I379N	probably damaging	Het

Other mutations in Ptprf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Ptprf	APN	4	118223220	splice site	probably benign
IGL01337:Ptprf	APN	4	118236291	missense	probably damaging	1.00
IGL01482:Ptprf	APN	4	118212454	missense	probably damaging	1.00
IGL01743:Ptprf	APN	4	118248898	critical splice donor site	probably null
IGL01987:Ptprf	APN	4	118277370	missense	probably benign
IGL02189:Ptprf	APN	4	118213642	splice site	probably benign
IGL03067:Ptprf	APN	4	118210713	missense	possibly damaging	0.67
PIT4677001:Ptprf	UTSW	4	118213612	missense	probably damaging	1.00
R0382:Ptprf	UTSW	4	118223394	splice site	probably benign
R0788:Ptprf	UTSW	4	118226466	missense	probably damaging	0.97
R1164:Ptprf	UTSW	4	118257492	missense	probably damaging	1.00
R1478:Ptprf	UTSW	4	118212105	nonsense	probably null
R1483:Ptprf	UTSW	4	118235964	missense	possibly damaging	0.81
R1611:Ptprf	UTSW	4	118236233	missense	probably benign	0.34
R1721:Ptprf	UTSW	4	118224899	missense	possibly damaging	0.56
R1817:Ptprf	UTSW	4	118223265	missense	probably benign	0.02
R1818:Ptprf	UTSW	4	118209871	missense	probably damaging	1.00
R1860:Ptprf	UTSW	4	118223932	missense	probably damaging	1.00
R2208:Ptprf	UTSW	4	118269172	splice site	probably benign
R2406:Ptprf	UTSW	4	118269304	missense	possibly damaging	0.62
R2912:Ptprf	UTSW	4	118248980	missense	probably damaging	0.98
R3111:Ptprf	UTSW	4	118211432	missense	probably damaging	1.00
R3498:Ptprf	UTSW	4	118224930	missense	probably damaging	0.99
R3499:Ptprf	UTSW	4	118224930	missense	probably damaging	0.99
R3615:Ptprf	UTSW	4	118237883	missense	probably benign	0.04
R3616:Ptprf	UTSW	4	118237883	missense	probably benign	0.04
R4038:Ptprf	UTSW	4	118257608	missense	probably damaging	1.00
R4243:Ptprf	UTSW	4	118226452	critical splice donor site	probably null
R4260:Ptprf	UTSW	4	118226083	missense	possibly damaging	0.64
R4693:Ptprf	UTSW	4	118211022	missense	probably benign	0.16
R4726:Ptprf	UTSW	4	118212217	missense	possibly damaging	0.86
R4746:Ptprf	UTSW	4	118225039	missense	possibly damaging	0.83
R4802:Ptprf	UTSW	4	118210329	intron	probably benign
R4857:Ptprf	UTSW	4	118217197	splice site	probably benign
R5071:Ptprf	UTSW	4	118211999	missense	probably damaging	1.00
R5221:Ptprf	UTSW	4	118225108	missense	probably benign	0.00
R5327:Ptprf	UTSW	4	118236389	missense	probably damaging	1.00
R5336:Ptprf	UTSW	4	118235634	missense	probably damaging	1.00
R5356:Ptprf	UTSW	4	118226338	missense	probably benign	0.00
R5373:Ptprf	UTSW	4	118226041	missense	possibly damaging	0.93
R5555:Ptprf	UTSW	4	118224924	missense	probably damaging	1.00
R5693:Ptprf	UTSW	4	118236177	nonsense	probably null
R5860:Ptprf	UTSW	4	118211289	intron	probably benign
R5869:Ptprf	UTSW	4	118210382	missense	probably damaging	1.00
R5890:Ptprf	UTSW	4	118224735	missense	probably benign
R5932:Ptprf	UTSW	4	118211767	missense	probably benign	0.10
R6028:Ptprf	UTSW	4	118213629	missense	probably benign	0.01
R6030:Ptprf	UTSW	4	118211048	missense	probably benign	0.19
R6030:Ptprf	UTSW	4	118211048	missense	probably benign	0.19
R6088:Ptprf	UTSW	4	118210755	missense	possibly damaging	0.68
R6089:Ptprf	UTSW	4	118211084	missense	probably damaging	0.99
R6108:Ptprf	UTSW	4	118223256	missense	probably benign	0.01
R6320:Ptprf	UTSW	4	118212814	missense	probably benign
R6741:Ptprf	UTSW	4	118223368	missense	probably benign	0.00
R6744:Ptprf	UTSW	4	118236365	missense	probably benign	0.00
R6750:Ptprf	UTSW	4	118231731	missense	probably benign	0.03
R6906:Ptprf	UTSW	4	118269277	missense	possibly damaging	0.95
R7021:Ptprf	UTSW	4	118223904	missense	probably benign	0.00
R7153:Ptprf	UTSW	4	118231543	missense	probably damaging	1.00
R7326:Ptprf	UTSW	4	118231669	missense	probably damaging	0.99
R7337:Ptprf	UTSW	4	118211125	missense	probably damaging	0.99
R7374:Ptprf	UTSW	4	118257492	missense	probably damaging	1.00
R7375:Ptprf	UTSW	4	118212814	missense	probably benign
R7399:Ptprf	UTSW	4	118226523	missense	probably benign	0.28
R7417:Ptprf	UTSW	4	118212172	missense	probably damaging	1.00
R7448:Ptprf	UTSW	4	118235667	missense	probably benign	0.03
R7530:Ptprf	UTSW	4	118212748	missense	probably damaging	1.00
R7593:Ptprf	UTSW	4	118212396	missense	probably benign	0.00
R8172:Ptprf	UTSW	4	118211078	missense	probably benign	0.03
R8239:Ptprf	UTSW	4	118212112	missense	possibly damaging	0.88
R8257:Ptprf	UTSW	4	118226279	missense	probably damaging	0.96
R8331:Ptprf	UTSW	4	118226066	missense	probably benign	0.27
R8441:Ptprf	UTSW	4	118218058	splice site	probably benign
R8681:Ptprf	UTSW	4	118231647	missense	probably benign	0.02
R8771:Ptprf	UTSW	4	118211790	missense	possibly damaging	0.95
R8815:Ptprf	UTSW	4	118237928	missense	possibly damaging	0.52
R8998:Ptprf	UTSW	4	118226474	missense	probably benign	0.00
R8999:Ptprf	UTSW	4	118226474	missense	probably benign	0.00
R9508:Ptprf	UTSW	4	118269579	nonsense	probably null
R9581:Ptprf	UTSW	4	118235060	missense	probably benign	0.00
X0067:Ptprf	UTSW	4	118236026	missense	possibly damaging	0.85
Z1177:Ptprf	UTSW	4	118269615	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- AGCCTCTGATGTCAGCTGTC -3'
(R):5'- CTCAGCCCCTTTTCGGAATATG -3'

Sequencing Primer
(F):5'- GATGTCAGCTGTCCATCTAGAAC -3'
(R):5'- ACCACCCAGTGAGGCAGTG -3'

Posted On

2022-04-18