Incidental Mutation 'R9389:Col9a2'
ID 710475
Institutional Source Beutler Lab
Gene Symbol Col9a2
Ensembl Gene ENSMUSG00000028626
Gene Name collagen, type IX, alpha 2
Synonyms Col9a-2
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9389 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 120896763-120912522 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120911948 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 675 (T675A)
Ref Sequence ENSEMBL: ENSMUSP00000030372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030372] [ENSMUST00000058754]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000030372
AA Change: T675A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: T675A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Collagen 24 82 7.3e-12 PFAM
Pfam:Collagen 59 115 2.4e-10 PFAM
Pfam:Collagen 113 170 2e-8 PFAM
Pfam:Collagen 176 236 8.9e-11 PFAM
low complexity region 258 277 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
Pfam:Collagen 357 435 4.4e-8 PFAM
Pfam:Collagen 459 523 6.1e-11 PFAM
Pfam:Collagen 548 610 4.5e-11 PFAM
low complexity region 639 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058754
SMART Domains Protein: ENSMUSP00000053900
Gene: ENSMUSG00000043207

DomainStartEndE-ValueType
Pfam:Peptidase_M48_N 41 225 2.5e-70 PFAM
Pfam:Peptidase_M48 228 473 5.5e-75 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,875,614 (GRCm39) V596I probably benign Het
Agtpbp1 A T 13: 59,613,884 (GRCm39) M1019K probably damaging Het
Arfgef3 A G 10: 18,479,271 (GRCm39) V1448A probably damaging Het
Baz1a T A 12: 54,963,608 (GRCm39) E828D probably damaging Het
Ces1f A T 8: 93,996,600 (GRCm39) probably null Het
Cfap53 T A 18: 74,432,414 (GRCm39) probably null Het
Col6a4 T C 9: 105,877,983 (GRCm39) Y1998C probably damaging Het
Dusp6 G A 10: 99,099,839 (GRCm39) V96M possibly damaging Het
Elmo1 T G 13: 20,369,661 (GRCm39) M22R probably benign Het
Fem1al A G 11: 29,775,107 (GRCm39) S117P probably damaging Het
Gm19965 A G 1: 116,749,566 (GRCm39) N416D Het
Gpr162 A G 6: 124,838,357 (GRCm39) Y98H probably damaging Het
Igfals G A 17: 25,100,600 (GRCm39) V564I probably benign Het
Il4 C T 11: 53,504,837 (GRCm39) R76H probably damaging Het
Itgb1 T A 8: 129,433,637 (GRCm39) N50K probably benign Het
Itpr3 A T 17: 27,314,899 (GRCm39) Y682F possibly damaging Het
Jak3 C T 8: 72,136,696 (GRCm39) P668S probably damaging Het
Malrd1 A T 2: 15,707,967 (GRCm39) N932I unknown Het
Mast4 C A 13: 103,470,438 (GRCm39) R88L probably benign Het
Mfsd11 T G 11: 116,764,161 (GRCm39) S381A probably benign Het
Mrm3 A G 11: 76,140,856 (GRCm39) D288G probably damaging Het
Myg1 G T 15: 102,245,372 (GRCm39) V198F probably damaging Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Npy6r T C 18: 44,408,759 (GRCm39) I60T probably damaging Het
Or12j3 T C 7: 139,952,930 (GRCm39) T198A probably benign Het
Or13p3 A T 4: 118,567,353 (GRCm39) M250L probably benign Het
Or4f57 G T 2: 111,790,872 (GRCm39) P182H probably damaging Het
Or5aq6 A T 2: 86,923,390 (GRCm39) M117K possibly damaging Het
Or5k14 C T 16: 58,692,976 (GRCm39) C179Y probably damaging Het
Or6c215 G A 10: 129,637,540 (GRCm39) P285S probably damaging Het
Ovgp1 CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA 3: 105,893,841 (GRCm39) probably benign Het
Oxtr C A 6: 112,466,310 (GRCm39) R150L probably damaging Het
Pappa A T 4: 65,099,125 (GRCm39) Y548F probably damaging Het
Pip4k2a T C 2: 18,912,890 (GRCm39) K73R probably damaging Het
Pla2g4f T A 2: 120,132,781 (GRCm39) D685V probably damaging Het
Ppp1r35 T A 5: 137,777,577 (GRCm39) L81Q probably damaging Het
Prss3b C T 6: 41,010,079 (GRCm39) G85D probably benign Het
Ptprf C A 4: 118,093,236 (GRCm39) A469S probably benign Het
Ranbp3l T A 15: 9,057,304 (GRCm39) N322K probably damaging Het
Rev3l T A 10: 39,698,967 (GRCm39) Y1155N possibly damaging Het
Rfesd T C 13: 76,151,131 (GRCm39) Y96C probably damaging Het
Runx1 C T 16: 92,410,568 (GRCm39) V283I possibly damaging Het
Sema5b A C 16: 35,466,092 (GRCm39) Q125P probably damaging Het
Skic3 A G 13: 76,275,158 (GRCm39) D403G probably benign Het
Spef2 A T 15: 9,725,307 (GRCm39) M150K probably damaging Het
Srcap T G 7: 127,141,455 (GRCm39) L1745W probably damaging Het
Srgap2 A G 1: 131,283,365 (GRCm39) Y239H probably damaging Het
Svil T A 18: 5,090,811 (GRCm39) H1304Q possibly damaging Het
Syne1 T C 10: 5,179,193 (GRCm39) D4427G possibly damaging Het
Tg T A 15: 66,561,173 (GRCm39) M1065K probably benign Het
Tgm2 T C 2: 157,959,816 (GRCm39) T656A probably benign Het
Ubr4 A G 4: 139,153,235 (GRCm39) K809E Het
Vmn1r88 T C 7: 12,912,546 (GRCm39) S301P probably damaging Het
Wdr27 A G 17: 15,111,980 (GRCm39) V671A possibly damaging Het
Zbtb17 G A 4: 141,193,131 (GRCm39) V550I possibly damaging Het
Zeb2 A T 2: 44,887,920 (GRCm39) I379N probably damaging Het
Other mutations in Col9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Col9a2 APN 4 120,902,389 (GRCm39) missense possibly damaging 0.95
IGL01978:Col9a2 APN 4 120,901,863 (GRCm39) missense unknown
IGL01995:Col9a2 APN 4 120,907,607 (GRCm39) critical splice donor site probably null
IGL02162:Col9a2 APN 4 120,911,531 (GRCm39) unclassified probably benign
IGL02931:Col9a2 APN 4 120,910,389 (GRCm39) missense probably benign 0.06
collision UTSW 4 120,906,913 (GRCm39) critical splice donor site probably null
gravity_wave UTSW 4 120,901,216 (GRCm39) critical splice donor site probably null
R0208:Col9a2 UTSW 4 120,909,485 (GRCm39) splice site probably benign
R0426:Col9a2 UTSW 4 120,901,857 (GRCm39) splice site probably benign
R0512:Col9a2 UTSW 4 120,911,504 (GRCm39) missense probably benign 0.22
R0973:Col9a2 UTSW 4 120,896,985 (GRCm39) critical splice donor site probably null
R1023:Col9a2 UTSW 4 120,901,207 (GRCm39) missense unknown
R1657:Col9a2 UTSW 4 120,898,171 (GRCm39) missense unknown
R1724:Col9a2 UTSW 4 120,911,099 (GRCm39) missense probably damaging 1.00
R2171:Col9a2 UTSW 4 120,902,198 (GRCm39) nonsense probably null
R2206:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2221:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2223:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2273:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2274:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2275:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2354:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2392:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2393:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2394:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3421:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3426:Col9a2 UTSW 4 120,907,604 (GRCm39) missense possibly damaging 0.93
R3710:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3821:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3838:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3839:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4067:Col9a2 UTSW 4 120,909,586 (GRCm39) missense probably damaging 1.00
R4298:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4299:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4595:Col9a2 UTSW 4 120,902,352 (GRCm39) missense probably benign 0.04
R4942:Col9a2 UTSW 4 120,910,316 (GRCm39) missense possibly damaging 0.73
R5120:Col9a2 UTSW 4 120,896,969 (GRCm39) missense unknown
R5434:Col9a2 UTSW 4 120,898,162 (GRCm39) nonsense probably null
R6143:Col9a2 UTSW 4 120,911,060 (GRCm39) missense probably damaging 0.99
R7027:Col9a2 UTSW 4 120,901,216 (GRCm39) critical splice donor site probably null
R7056:Col9a2 UTSW 4 120,906,913 (GRCm39) critical splice donor site probably null
R7417:Col9a2 UTSW 4 120,911,489 (GRCm39) missense not run
R7571:Col9a2 UTSW 4 120,896,981 (GRCm39) missense unknown
R9120:Col9a2 UTSW 4 120,900,951 (GRCm39) splice site probably benign
R9341:Col9a2 UTSW 4 120,911,483 (GRCm39) missense probably benign 0.03
R9343:Col9a2 UTSW 4 120,911,483 (GRCm39) missense probably benign 0.03
R9527:Col9a2 UTSW 4 120,899,528 (GRCm39) critical splice donor site probably null
R9620:Col9a2 UTSW 4 120,910,403 (GRCm39) critical splice donor site probably null
R9784:Col9a2 UTSW 4 120,898,226 (GRCm39) missense unknown
Z1176:Col9a2 UTSW 4 120,910,994 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACAGTCGTGTTCTAGTTTTCC -3'
(R):5'- ACTTGTCTTCAGAACCCCTGG -3'

Sequencing Primer
(F):5'- GCCTACACAATTTTCTGGCAG -3'
(R):5'- TTCAGAACCCCTGGATCTTGGG -3'
Posted On 2022-04-18