Incidental Mutation 'R9389:Col9a2'
ID 710475
Institutional Source Beutler Lab
Gene Symbol Col9a2
Ensembl Gene ENSMUSG00000028626
Gene Name collagen, type IX, alpha 2
Synonyms Col9a-2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9389 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 121039385-121055322 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121054751 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 675 (T675A)
Ref Sequence ENSEMBL: ENSMUSP00000030372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030372] [ENSMUST00000058754]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000030372
AA Change: T675A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: T675A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Collagen 24 82 7.3e-12 PFAM
Pfam:Collagen 59 115 2.4e-10 PFAM
Pfam:Collagen 113 170 2e-8 PFAM
Pfam:Collagen 176 236 8.9e-11 PFAM
low complexity region 258 277 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
Pfam:Collagen 357 435 4.4e-8 PFAM
Pfam:Collagen 459 523 6.1e-11 PFAM
Pfam:Collagen 548 610 4.5e-11 PFAM
low complexity region 639 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058754
SMART Domains Protein: ENSMUSP00000053900
Gene: ENSMUSG00000043207

DomainStartEndE-ValueType
Pfam:Peptidase_M48_N 41 225 2.5e-70 PFAM
Pfam:Peptidase_M48 228 473 5.5e-75 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik C T 6: 41,033,145 G85D probably benign Het
4931440F15Rik A G 11: 29,825,107 S117P probably damaging Het
Abcb1b G A 5: 8,825,614 V596I probably benign Het
Agtpbp1 A T 13: 59,466,070 M1019K probably damaging Het
Arfgef3 A G 10: 18,603,523 V1448A probably damaging Het
Baz1a T A 12: 54,916,823 E828D probably damaging Het
Ces1f A T 8: 93,269,972 probably null Het
Cfap53 T A 18: 74,299,343 probably null Het
Col6a4 T C 9: 106,000,784 Y1998C probably damaging Het
Dusp6 G A 10: 99,263,977 V96M possibly damaging Het
Elmo1 T G 13: 20,185,491 M22R probably benign Het
Gm19965 A G 1: 116,821,836 N416D Het
Gpr162 A G 6: 124,861,394 Y98H probably damaging Het
Igfals G A 17: 24,881,626 V564I probably benign Het
Il4 C T 11: 53,614,010 R76H probably damaging Het
Itgb1 T A 8: 128,707,156 N50K probably benign Het
Itpr3 A T 17: 27,095,925 Y682F possibly damaging Het
Jak3 C T 8: 71,684,052 P668S probably damaging Het
Malrd1 A T 2: 15,703,156 N932I unknown Het
Mast4 C A 13: 103,333,930 R88L probably benign Het
Mfsd11 T G 11: 116,873,335 S381A probably benign Het
Mrm3 A G 11: 76,250,030 D288G probably damaging Het
Myg1 G T 15: 102,336,937 V198F probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Npy6r T C 18: 44,275,692 I60T probably damaging Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr1308 G T 2: 111,960,527 P182H probably damaging Het
Olfr1341 A T 4: 118,710,156 M250L probably benign Het
Olfr177 C T 16: 58,872,613 C179Y probably damaging Het
Olfr530 T C 7: 140,373,017 T198A probably benign Het
Olfr811 G A 10: 129,801,671 P285S probably damaging Het
Ovgp1 CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA 3: 105,986,525 probably benign Het
Oxtr C A 6: 112,489,349 R150L probably damaging Het
Pappa A T 4: 65,180,888 Y548F probably damaging Het
Pip4k2a T C 2: 18,908,079 K73R probably damaging Het
Pla2g4f T A 2: 120,302,300 D685V probably damaging Het
Ppp1r35 T A 5: 137,779,315 L81Q probably damaging Het
Ptprf C A 4: 118,236,039 A469S probably benign Het
Ranbp3l T A 15: 9,057,223 N322K probably damaging Het
Rev3l T A 10: 39,822,971 Y1155N possibly damaging Het
Rfesd T C 13: 76,003,012 Y96C probably damaging Het
Runx1 C T 16: 92,613,680 V283I possibly damaging Het
Sema5b A C 16: 35,645,722 Q125P probably damaging Het
Spef2 A T 15: 9,725,221 M150K probably damaging Het
Srcap T G 7: 127,542,283 L1745W probably damaging Het
Srgap2 A G 1: 131,355,627 Y239H probably damaging Het
Svil T A 18: 5,090,811 H1304Q possibly damaging Het
Syne1 T C 10: 5,229,193 D4427G possibly damaging Het
Tg T A 15: 66,689,324 M1065K probably benign Het
Tgm2 T C 2: 158,117,896 T656A probably benign Het
Ttc37 A G 13: 76,127,039 D403G probably benign Het
Ubr4 A G 4: 139,425,924 K809E Het
Vmn1r88 T C 7: 13,178,619 S301P probably damaging Het
Wdr27 A G 17: 14,891,718 V671A possibly damaging Het
Zbtb17 G A 4: 141,465,820 V550I possibly damaging Het
Zeb2 A T 2: 44,997,908 I379N probably damaging Het
Other mutations in Col9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Col9a2 APN 4 121045192 missense possibly damaging 0.95
IGL01978:Col9a2 APN 4 121044666 missense unknown
IGL01995:Col9a2 APN 4 121050410 critical splice donor site probably null
IGL02162:Col9a2 APN 4 121054334 unclassified probably benign
IGL02931:Col9a2 APN 4 121053192 missense probably benign 0.06
collision UTSW 4 121049716 critical splice donor site probably null
gravity_wave UTSW 4 121044019 critical splice donor site probably null
R0208:Col9a2 UTSW 4 121052288 splice site probably benign
R0426:Col9a2 UTSW 4 121044660 splice site probably benign
R0512:Col9a2 UTSW 4 121054307 missense probably benign 0.22
R0973:Col9a2 UTSW 4 121039788 critical splice donor site probably null
R1023:Col9a2 UTSW 4 121044010 missense unknown
R1657:Col9a2 UTSW 4 121040974 missense unknown
R1724:Col9a2 UTSW 4 121053902 missense probably damaging 1.00
R2171:Col9a2 UTSW 4 121045001 nonsense probably null
R2206:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2221:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2223:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2273:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2274:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2275:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2354:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2392:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2393:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2394:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3421:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3426:Col9a2 UTSW 4 121050407 missense possibly damaging 0.93
R3710:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3821:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3838:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3839:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4067:Col9a2 UTSW 4 121052389 missense probably damaging 1.00
R4298:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4299:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4595:Col9a2 UTSW 4 121045155 missense probably benign 0.04
R4942:Col9a2 UTSW 4 121053119 missense possibly damaging 0.73
R5120:Col9a2 UTSW 4 121039772 missense unknown
R5434:Col9a2 UTSW 4 121040965 nonsense probably null
R6143:Col9a2 UTSW 4 121053863 missense probably damaging 0.99
R7027:Col9a2 UTSW 4 121044019 critical splice donor site probably null
R7056:Col9a2 UTSW 4 121049716 critical splice donor site probably null
R7417:Col9a2 UTSW 4 121054292 missense not run
R7571:Col9a2 UTSW 4 121039784 missense unknown
R9120:Col9a2 UTSW 4 121043754 splice site probably benign
R9341:Col9a2 UTSW 4 121054286 missense probably benign 0.03
R9343:Col9a2 UTSW 4 121054286 missense probably benign 0.03
R9527:Col9a2 UTSW 4 121042331 critical splice donor site probably null
R9620:Col9a2 UTSW 4 121053206 critical splice donor site probably null
R9784:Col9a2 UTSW 4 121041029 missense unknown
Z1176:Col9a2 UTSW 4 121053797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACAGTCGTGTTCTAGTTTTCC -3'
(R):5'- ACTTGTCTTCAGAACCCCTGG -3'

Sequencing Primer
(F):5'- GCCTACACAATTTTCTGGCAG -3'
(R):5'- TTCAGAACCCCTGGATCTTGGG -3'
Posted On 2022-04-18