Mutagenetix > Incidental Mutation

Incidental Mutation 'R9389:Itgb1'

710488

Institutional Source

Beutler Lab

Gene Symbol

Itgb1

Ensembl Gene

ENSMUSG00000025809

Gene Name

integrin beta 1 (fibronectin receptor beta)

Synonyms

Gm9863, Fnrb, CD29, 4633401G24Rik, beta1 integrin

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9389 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128685654-128733200 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 128707156 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 50 (N50K)

Ref Sequence

ENSEMBL: ENSMUSP00000087457 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090006] [ENSMUST00000124826]

AlphaFold

P09055

Predicted Effect

probably benign
Transcript: ENSMUST00000090006
AA Change: N50K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000087457
Gene: ENSMUSG00000025809
AA Change: N50K

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PSI	26	76	3.01e-7	SMART
INB	34	464	2e-298	SMART
VWA	142	372	1.45e0	SMART
low complexity region	568	581	N/A	INTRINSIC
Pfam:EGF_2	599	630	8.8e-8	PFAM
Integrin_B_tail	640	728	4.58e-37	SMART
transmembrane domain	729	751	N/A	INTRINSIC
Integrin_b_cyt	752	798	3.43e-27	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124826
AA Change: N50K

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000120026
Gene: ENSMUSG00000025809
AA Change: N50K

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PDB:3VI4\|D	21	51	2e-16	PDB
Blast:PSI	26	51	1e-11	BLAST

Meta Mutation Damage Score

0.1172

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric proteins made up of alpha and beta subunits. At least 18 alpha and 8 beta subunits have been described in mammals. Integrin family members are membrane receptors involved in cell adhesion and recognition in a variety of processes including embryogenesis, hemostasis, tissue repair, immune response and metastatic diffusion of tumor cells. This gene encodes a beta subunit. Multiple alternatively spliced transcript variants which encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants die at or soon after implantation. Tissue-specific knockouts exhibit skin blisters, hair-loss, brain and heart defects, and impaired immune responses, wound healing, and hematopoietic stem cell migration, respectively. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	C	T	6: 41,033,145	G85D	probably benign	Het
4931440F15Rik	A	G	11: 29,825,107	S117P	probably damaging	Het
Abcb1b	G	A	5: 8,825,614	V596I	probably benign	Het
Agtpbp1	A	T	13: 59,466,070	M1019K	probably damaging	Het
Arfgef3	A	G	10: 18,603,523	V1448A	probably damaging	Het
Baz1a	T	A	12: 54,916,823	E828D	probably damaging	Het
Ces1f	A	T	8: 93,269,972		probably null	Het
Cfap53	T	A	18: 74,299,343		probably null	Het
Col6a4	T	C	9: 106,000,784	Y1998C	probably damaging	Het
Col9a2	A	G	4: 121,054,751	T675A	probably benign	Het
Dusp6	G	A	10: 99,263,977	V96M	possibly damaging	Het
Elmo1	T	G	13: 20,185,491	M22R	probably benign	Het
Gm19965	A	G	1: 116,821,836	N416D		Het
Gpr162	A	G	6: 124,861,394	Y98H	probably damaging	Het
Igfals	G	A	17: 24,881,626	V564I	probably benign	Het
Il4	C	T	11: 53,614,010	R76H	probably damaging	Het
Itpr3	A	T	17: 27,095,925	Y682F	possibly damaging	Het
Jak3	C	T	8: 71,684,052	P668S	probably damaging	Het
Malrd1	A	T	2: 15,703,156	N932I	unknown	Het
Mast4	C	A	13: 103,333,930	R88L	probably benign	Het
Mfsd11	T	G	11: 116,873,335	S381A	probably benign	Het
Mrm3	A	G	11: 76,250,030	D288G	probably damaging	Het
Myg1	G	T	15: 102,336,937	V198F	probably damaging	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Npy6r	T	C	18: 44,275,692	I60T	probably damaging	Het
Olfr1109	A	T	2: 87,093,046	M117K	possibly damaging	Het
Olfr1308	G	T	2: 111,960,527	P182H	probably damaging	Het
Olfr1341	A	T	4: 118,710,156	M250L	probably benign	Het
Olfr177	C	T	16: 58,872,613	C179Y	probably damaging	Het
Olfr530	T	C	7: 140,373,017	T198A	probably benign	Het
Olfr811	G	A	10: 129,801,671	P285S	probably damaging	Het
Ovgp1	CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA	CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA	3: 105,986,525		probably benign	Het
Oxtr	C	A	6: 112,489,349	R150L	probably damaging	Het
Pappa	A	T	4: 65,180,888	Y548F	probably damaging	Het
Pip4k2a	T	C	2: 18,908,079	K73R	probably damaging	Het
Pla2g4f	T	A	2: 120,302,300	D685V	probably damaging	Het
Ppp1r35	T	A	5: 137,779,315	L81Q	probably damaging	Het
Ptprf	C	A	4: 118,236,039	A469S	probably benign	Het
Ranbp3l	T	A	15: 9,057,223	N322K	probably damaging	Het
Rev3l	T	A	10: 39,822,971	Y1155N	possibly damaging	Het
Rfesd	T	C	13: 76,003,012	Y96C	probably damaging	Het
Runx1	C	T	16: 92,613,680	V283I	possibly damaging	Het
Sema5b	A	C	16: 35,645,722	Q125P	probably damaging	Het
Spef2	A	T	15: 9,725,221	M150K	probably damaging	Het
Srcap	T	G	7: 127,542,283	L1745W	probably damaging	Het
Srgap2	A	G	1: 131,355,627	Y239H	probably damaging	Het
Svil	T	A	18: 5,090,811	H1304Q	possibly damaging	Het
Syne1	T	C	10: 5,229,193	D4427G	possibly damaging	Het
Tg	T	A	15: 66,689,324	M1065K	probably benign	Het
Tgm2	T	C	2: 158,117,896	T656A	probably benign	Het
Ttc37	A	G	13: 76,127,039	D403G	probably benign	Het
Ubr4	A	G	4: 139,425,924	K809E		Het
Vmn1r88	T	C	7: 13,178,619	S301P	probably damaging	Het
Wdr27	A	G	17: 14,891,718	V671A	possibly damaging	Het
Zbtb17	G	A	4: 141,465,820	V550I	possibly damaging	Het
Zeb2	A	T	2: 44,997,908	I379N	probably damaging	Het

Other mutations in Itgb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Itgb1	APN	8	128713918	splice site	probably benign
IGL01407:Itgb1	APN	8	128722834	missense	probably benign	0.08
IGL03025:Itgb1	APN	8	128722584	missense	possibly damaging	0.96
Drystacked	UTSW	8	128732054	missense	possibly damaging	0.79
Jumble	UTSW	8	128714116	missense	probably damaging	1.00
PIT4377001:Itgb1	UTSW	8	128710383	missense	probably damaging	1.00
R0136:Itgb1	UTSW	8	128722854	missense	possibly damaging	0.96
R0244:Itgb1	UTSW	8	128717685	splice site	probably benign
R0483:Itgb1	UTSW	8	128726167	missense	possibly damaging	0.79
R0606:Itgb1	UTSW	8	128722372	unclassified	probably benign
R0657:Itgb1	UTSW	8	128722854	missense	possibly damaging	0.96
R0865:Itgb1	UTSW	8	128710251	critical splice acceptor site	probably null
R1052:Itgb1	UTSW	8	128713305	missense	probably damaging	1.00
R1429:Itgb1	UTSW	8	128717676	critical splice donor site	probably null
R1589:Itgb1	UTSW	8	128705458	missense	probably damaging	0.99
R1589:Itgb1	UTSW	8	128705459	missense	possibly damaging	0.95
R1614:Itgb1	UTSW	8	128720065	missense	probably damaging	1.00
R1672:Itgb1	UTSW	8	128732045	missense	probably damaging	1.00
R1723:Itgb1	UTSW	8	128726038	missense	probably damaging	0.98
R1865:Itgb1	UTSW	8	128720457	missense	probably benign	0.01
R3786:Itgb1	UTSW	8	128713358	missense	probably damaging	1.00
R4223:Itgb1	UTSW	8	128714143	missense	probably damaging	1.00
R4756:Itgb1	UTSW	8	128717222	missense	probably damaging	0.98
R4826:Itgb1	UTSW	8	128720308	missense	probably damaging	1.00
R4880:Itgb1	UTSW	8	128716150	missense	probably damaging	1.00
R5202:Itgb1	UTSW	8	128720010	missense	probably damaging	0.99
R5682:Itgb1	UTSW	8	128727068	splice site	probably null
R5935:Itgb1	UTSW	8	128713237	nonsense	probably null
R6156:Itgb1	UTSW	8	128732054	missense	possibly damaging	0.79
R6160:Itgb1	UTSW	8	128720283	missense	possibly damaging	0.95
R6248:Itgb1	UTSW	8	128722421	missense	possibly damaging	0.80
R6812:Itgb1	UTSW	8	128705410	splice site	probably null
R6869:Itgb1	UTSW	8	128720035	missense	probably benign	0.01
R7249:Itgb1	UTSW	8	128720404	missense	probably benign	0.28
R7496:Itgb1	UTSW	8	128720305	missense	probably benign
R7679:Itgb1	UTSW	8	128720448	missense	probably damaging	0.99
R7787:Itgb1	UTSW	8	128727018	missense	probably benign	0.32
R7800:Itgb1	UTSW	8	128713237	missense	possibly damaging	0.89
R8015:Itgb1	UTSW	8	128722401	missense	possibly damaging	0.79
R8687:Itgb1	UTSW	8	128716216	missense	probably damaging	1.00
R8709:Itgb1	UTSW	8	128713406	intron	probably benign
R8979:Itgb1	UTSW	8	128722470	missense	probably benign	0.05
R9243:Itgb1	UTSW	8	128707106	missense	probably benign	0.36
R9398:Itgb1	UTSW	8	128726124	missense	probably damaging	1.00
Z1088:Itgb1	UTSW	8	128713369	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGTAACTGGGCTGCATTTGTTC -3'
(R):5'- GTCCAAACAGCTGAGTGAAGAC -3'

Sequencing Primer
(F):5'- CTGGGCTGCATTTGTTCATTTTTAAC -3'
(R):5'- CATGGACTGACACTCTGCTTTGAG -3'

Posted On

2022-04-18