Incidental Mutation 'R9389:Col6a4'
ID 710489
Institutional Source Beutler Lab
Gene Symbol Col6a4
Ensembl Gene ENSMUSG00000032572
Gene Name collagen, type VI, alpha 4
Synonyms Vwa6, EG235580, 1110001D15Rik, Dvwa
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9389 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 105866653-105973982 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 105877983 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1998 (Y1998C)
Ref Sequence ENSEMBL: ENSMUSP00000112472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121963]
AlphaFold A2AX52
Predicted Effect probably damaging
Transcript: ENSMUST00000121963
AA Change: Y1998C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572
AA Change: Y1998C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWA 32 211 2.44e-35 SMART
VWA 233 410 8.67e-50 SMART
VWA 428 604 2.74e-29 SMART
VWA 632 816 4.78e-20 SMART
VWA 847 1019 3.02e-40 SMART
VWA 1028 1204 3.17e-43 SMART
VWA 1210 1391 4.73e-1 SMART
low complexity region 1444 1462 N/A INTRINSIC
PDB:3HR2|B 1469 1593 3e-7 PDB
low complexity region 1594 1622 N/A INTRINSIC
low complexity region 1625 1643 N/A INTRINSIC
low complexity region 1649 1671 N/A INTRINSIC
Pfam:Collagen 1684 1748 1.4e-9 PFAM
VWA 1774 1953 2.18e-14 SMART
VWA 1980 2174 1.89e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218471
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,875,614 (GRCm39) V596I probably benign Het
Agtpbp1 A T 13: 59,613,884 (GRCm39) M1019K probably damaging Het
Arfgef3 A G 10: 18,479,271 (GRCm39) V1448A probably damaging Het
Baz1a T A 12: 54,963,608 (GRCm39) E828D probably damaging Het
Ces1f A T 8: 93,996,600 (GRCm39) probably null Het
Cfap53 T A 18: 74,432,414 (GRCm39) probably null Het
Col9a2 A G 4: 120,911,948 (GRCm39) T675A probably benign Het
Dusp6 G A 10: 99,099,839 (GRCm39) V96M possibly damaging Het
Elmo1 T G 13: 20,369,661 (GRCm39) M22R probably benign Het
Fem1al A G 11: 29,775,107 (GRCm39) S117P probably damaging Het
Gm19965 A G 1: 116,749,566 (GRCm39) N416D Het
Gpr162 A G 6: 124,838,357 (GRCm39) Y98H probably damaging Het
Igfals G A 17: 25,100,600 (GRCm39) V564I probably benign Het
Il4 C T 11: 53,504,837 (GRCm39) R76H probably damaging Het
Itgb1 T A 8: 129,433,637 (GRCm39) N50K probably benign Het
Itpr3 A T 17: 27,314,899 (GRCm39) Y682F possibly damaging Het
Jak3 C T 8: 72,136,696 (GRCm39) P668S probably damaging Het
Malrd1 A T 2: 15,707,967 (GRCm39) N932I unknown Het
Mast4 C A 13: 103,470,438 (GRCm39) R88L probably benign Het
Mfsd11 T G 11: 116,764,161 (GRCm39) S381A probably benign Het
Mrm3 A G 11: 76,140,856 (GRCm39) D288G probably damaging Het
Myg1 G T 15: 102,245,372 (GRCm39) V198F probably damaging Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Npy6r T C 18: 44,408,759 (GRCm39) I60T probably damaging Het
Or12j3 T C 7: 139,952,930 (GRCm39) T198A probably benign Het
Or13p3 A T 4: 118,567,353 (GRCm39) M250L probably benign Het
Or4f57 G T 2: 111,790,872 (GRCm39) P182H probably damaging Het
Or5aq6 A T 2: 86,923,390 (GRCm39) M117K possibly damaging Het
Or5k14 C T 16: 58,692,976 (GRCm39) C179Y probably damaging Het
Or6c215 G A 10: 129,637,540 (GRCm39) P285S probably damaging Het
Ovgp1 CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA 3: 105,893,841 (GRCm39) probably benign Het
Oxtr C A 6: 112,466,310 (GRCm39) R150L probably damaging Het
Pappa A T 4: 65,099,125 (GRCm39) Y548F probably damaging Het
Pip4k2a T C 2: 18,912,890 (GRCm39) K73R probably damaging Het
Pla2g4f T A 2: 120,132,781 (GRCm39) D685V probably damaging Het
Ppp1r35 T A 5: 137,777,577 (GRCm39) L81Q probably damaging Het
Prss3b C T 6: 41,010,079 (GRCm39) G85D probably benign Het
Ptprf C A 4: 118,093,236 (GRCm39) A469S probably benign Het
Ranbp3l T A 15: 9,057,304 (GRCm39) N322K probably damaging Het
Rev3l T A 10: 39,698,967 (GRCm39) Y1155N possibly damaging Het
Rfesd T C 13: 76,151,131 (GRCm39) Y96C probably damaging Het
Runx1 C T 16: 92,410,568 (GRCm39) V283I possibly damaging Het
Sema5b A C 16: 35,466,092 (GRCm39) Q125P probably damaging Het
Skic3 A G 13: 76,275,158 (GRCm39) D403G probably benign Het
Spef2 A T 15: 9,725,307 (GRCm39) M150K probably damaging Het
Srcap T G 7: 127,141,455 (GRCm39) L1745W probably damaging Het
Srgap2 A G 1: 131,283,365 (GRCm39) Y239H probably damaging Het
Svil T A 18: 5,090,811 (GRCm39) H1304Q possibly damaging Het
Syne1 T C 10: 5,179,193 (GRCm39) D4427G possibly damaging Het
Tg T A 15: 66,561,173 (GRCm39) M1065K probably benign Het
Tgm2 T C 2: 157,959,816 (GRCm39) T656A probably benign Het
Ubr4 A G 4: 139,153,235 (GRCm39) K809E Het
Vmn1r88 T C 7: 12,912,546 (GRCm39) S301P probably damaging Het
Wdr27 A G 17: 15,111,980 (GRCm39) V671A possibly damaging Het
Zbtb17 G A 4: 141,193,131 (GRCm39) V550I possibly damaging Het
Zeb2 A T 2: 44,887,920 (GRCm39) I379N probably damaging Het
Other mutations in Col6a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Col6a4 APN 9 105,900,095 (GRCm39) missense probably benign 0.00
IGL00691:Col6a4 APN 9 105,934,606 (GRCm39) missense probably damaging 1.00
IGL01508:Col6a4 APN 9 105,890,804 (GRCm39) missense possibly damaging 0.95
IGL01580:Col6a4 APN 9 105,945,397 (GRCm39) missense probably damaging 1.00
IGL01610:Col6a4 APN 9 105,924,906 (GRCm39) splice site probably benign
IGL01813:Col6a4 APN 9 105,954,452 (GRCm39) missense probably damaging 1.00
IGL01933:Col6a4 APN 9 105,937,313 (GRCm39) missense probably benign 0.04
IGL01973:Col6a4 APN 9 105,940,093 (GRCm39) missense probably damaging 1.00
IGL02053:Col6a4 APN 9 105,940,294 (GRCm39) missense possibly damaging 0.92
IGL02063:Col6a4 APN 9 105,934,617 (GRCm39) missense probably benign 0.01
IGL02065:Col6a4 APN 9 105,954,302 (GRCm39) missense probably damaging 0.99
IGL02106:Col6a4 APN 9 105,940,304 (GRCm39) missense possibly damaging 0.95
IGL02220:Col6a4 APN 9 105,940,141 (GRCm39) missense possibly damaging 0.91
IGL02228:Col6a4 APN 9 105,945,277 (GRCm39) missense probably benign
IGL02234:Col6a4 APN 9 105,890,631 (GRCm39) missense possibly damaging 0.92
IGL02294:Col6a4 APN 9 105,943,931 (GRCm39) missense probably benign 0.04
IGL02314:Col6a4 APN 9 105,874,355 (GRCm39) missense probably damaging 0.99
IGL03065:Col6a4 APN 9 105,918,363 (GRCm39) splice site probably benign
IGL03086:Col6a4 APN 9 105,960,061 (GRCm39) splice site probably benign
IGL03185:Col6a4 APN 9 105,896,653 (GRCm39) missense probably damaging 0.97
R0092:Col6a4 UTSW 9 105,890,513 (GRCm39) missense probably benign 0.04
R0095:Col6a4 UTSW 9 105,952,555 (GRCm39) missense probably benign 0.03
R0230:Col6a4 UTSW 9 105,949,565 (GRCm39) missense probably benign 0.11
R0359:Col6a4 UTSW 9 105,874,345 (GRCm39) missense probably benign
R0415:Col6a4 UTSW 9 105,952,279 (GRCm39) missense probably damaging 0.99
R0433:Col6a4 UTSW 9 105,945,193 (GRCm39) missense probably damaging 0.99
R0450:Col6a4 UTSW 9 105,957,746 (GRCm39) missense probably damaging 1.00
R0469:Col6a4 UTSW 9 105,957,746 (GRCm39) missense probably damaging 1.00
R0490:Col6a4 UTSW 9 105,890,969 (GRCm39) missense probably damaging 0.99
R0621:Col6a4 UTSW 9 105,943,990 (GRCm39) missense probably damaging 0.97
R0667:Col6a4 UTSW 9 105,907,158 (GRCm39) splice site probably benign
R0681:Col6a4 UTSW 9 105,944,343 (GRCm39) nonsense probably null
R0690:Col6a4 UTSW 9 105,905,386 (GRCm39) splice site probably benign
R0714:Col6a4 UTSW 9 105,895,102 (GRCm39) unclassified probably benign
R0788:Col6a4 UTSW 9 105,949,197 (GRCm39) missense probably benign 0.15
R1036:Col6a4 UTSW 9 105,945,397 (GRCm39) missense probably damaging 1.00
R1296:Col6a4 UTSW 9 105,940,052 (GRCm39) missense possibly damaging 0.47
R1386:Col6a4 UTSW 9 105,940,144 (GRCm39) missense probably benign 0.15
R1484:Col6a4 UTSW 9 105,890,501 (GRCm39) critical splice donor site probably null
R1528:Col6a4 UTSW 9 105,952,419 (GRCm39) missense probably damaging 0.99
R1555:Col6a4 UTSW 9 105,878,085 (GRCm39) missense possibly damaging 0.93
R1622:Col6a4 UTSW 9 105,874,334 (GRCm39) missense probably benign 0.01
R1653:Col6a4 UTSW 9 105,949,608 (GRCm39) missense probably damaging 0.99
R1720:Col6a4 UTSW 9 105,903,671 (GRCm39) missense probably damaging 1.00
R1768:Col6a4 UTSW 9 105,957,299 (GRCm39) missense probably benign
R1941:Col6a4 UTSW 9 105,952,209 (GRCm39) missense probably benign 0.00
R2092:Col6a4 UTSW 9 105,937,530 (GRCm39) missense probably damaging 1.00
R2134:Col6a4 UTSW 9 105,943,860 (GRCm39) missense probably benign 0.09
R2149:Col6a4 UTSW 9 105,954,128 (GRCm39) missense probably benign 0.00
R2174:Col6a4 UTSW 9 105,937,331 (GRCm39) missense probably damaging 0.98
R2204:Col6a4 UTSW 9 105,937,331 (GRCm39) missense probably damaging 0.98
R2248:Col6a4 UTSW 9 105,957,158 (GRCm39) missense probably benign 0.15
R2568:Col6a4 UTSW 9 105,940,275 (GRCm39) missense possibly damaging 0.90
R3750:Col6a4 UTSW 9 105,897,864 (GRCm39) critical splice acceptor site probably null
R3751:Col6a4 UTSW 9 105,949,313 (GRCm39) missense probably damaging 0.98
R3776:Col6a4 UTSW 9 105,928,900 (GRCm39) nonsense probably null
R3872:Col6a4 UTSW 9 105,890,858 (GRCm39) missense possibly damaging 0.95
R4043:Col6a4 UTSW 9 105,949,610 (GRCm39) nonsense probably null
R4056:Col6a4 UTSW 9 105,903,665 (GRCm39) missense probably damaging 0.98
R4212:Col6a4 UTSW 9 105,952,569 (GRCm39) missense probably benign 0.28
R4417:Col6a4 UTSW 9 105,949,215 (GRCm39) missense probably damaging 0.99
R4683:Col6a4 UTSW 9 105,957,329 (GRCm39) missense probably benign 0.00
R4719:Col6a4 UTSW 9 105,945,451 (GRCm39) missense probably damaging 0.99
R4791:Col6a4 UTSW 9 105,957,401 (GRCm39) missense possibly damaging 0.68
R4833:Col6a4 UTSW 9 105,949,178 (GRCm39) missense probably benign 0.00
R4886:Col6a4 UTSW 9 105,937,271 (GRCm39) missense probably benign 0.00
R4998:Col6a4 UTSW 9 105,867,977 (GRCm39) utr 3 prime probably benign
R5091:Col6a4 UTSW 9 105,952,262 (GRCm39) missense probably damaging 1.00
R5113:Col6a4 UTSW 9 105,944,159 (GRCm39) missense possibly damaging 0.89
R5129:Col6a4 UTSW 9 105,890,576 (GRCm39) missense probably damaging 0.98
R5231:Col6a4 UTSW 9 105,902,730 (GRCm39) missense probably damaging 0.96
R5297:Col6a4 UTSW 9 105,952,066 (GRCm39) missense probably benign 0.02
R5352:Col6a4 UTSW 9 105,938,743 (GRCm39) missense probably damaging 1.00
R5438:Col6a4 UTSW 9 105,890,895 (GRCm39) missense possibly damaging 0.95
R5518:Col6a4 UTSW 9 105,949,387 (GRCm39) missense possibly damaging 0.68
R5657:Col6a4 UTSW 9 105,949,397 (GRCm39) missense probably damaging 0.99
R5660:Col6a4 UTSW 9 105,873,315 (GRCm39) missense probably benign 0.01
R5662:Col6a4 UTSW 9 105,945,200 (GRCm39) missense probably damaging 0.99
R5777:Col6a4 UTSW 9 105,890,895 (GRCm39) missense possibly damaging 0.95
R5800:Col6a4 UTSW 9 105,957,474 (GRCm39) missense probably damaging 0.99
R5929:Col6a4 UTSW 9 105,940,243 (GRCm39) missense probably benign 0.15
R5999:Col6a4 UTSW 9 105,945,120 (GRCm39) missense probably benign 0.11
R6243:Col6a4 UTSW 9 105,890,589 (GRCm39) missense possibly damaging 0.95
R6285:Col6a4 UTSW 9 105,952,185 (GRCm39) missense probably damaging 0.96
R6288:Col6a4 UTSW 9 105,945,462 (GRCm39) missense probably damaging 0.99
R6361:Col6a4 UTSW 9 105,943,902 (GRCm39) missense probably benign 0.28
R6485:Col6a4 UTSW 9 105,954,069 (GRCm39) critical splice donor site probably null
R6490:Col6a4 UTSW 9 105,952,191 (GRCm39) nonsense probably null
R6537:Col6a4 UTSW 9 105,945,153 (GRCm39) missense possibly damaging 0.87
R6598:Col6a4 UTSW 9 105,877,611 (GRCm39) missense probably damaging 0.99
R6643:Col6a4 UTSW 9 105,877,830 (GRCm39) missense probably damaging 0.96
R6905:Col6a4 UTSW 9 105,937,517 (GRCm39) splice site probably null
R6944:Col6a4 UTSW 9 105,949,370 (GRCm39) missense probably damaging 0.98
R7015:Col6a4 UTSW 9 105,910,954 (GRCm39) critical splice donor site probably null
R7027:Col6a4 UTSW 9 105,944,213 (GRCm39) missense probably damaging 1.00
R7088:Col6a4 UTSW 9 105,877,885 (GRCm39) missense possibly damaging 0.56
R7200:Col6a4 UTSW 9 105,949,448 (GRCm39) missense possibly damaging 0.68
R7238:Col6a4 UTSW 9 105,877,519 (GRCm39) missense probably damaging 0.99
R7273:Col6a4 UTSW 9 105,877,656 (GRCm39) missense possibly damaging 0.92
R7335:Col6a4 UTSW 9 105,954,091 (GRCm39) missense possibly damaging 0.90
R7418:Col6a4 UTSW 9 105,900,114 (GRCm39) missense probably damaging 1.00
R7421:Col6a4 UTSW 9 105,897,994 (GRCm39) missense probably damaging 0.99
R7530:Col6a4 UTSW 9 105,945,589 (GRCm39) missense probably damaging 0.99
R7600:Col6a4 UTSW 9 105,944,198 (GRCm39) missense possibly damaging 0.86
R7701:Col6a4 UTSW 9 105,960,087 (GRCm39) missense probably benign 0.17
R7830:Col6a4 UTSW 9 105,952,589 (GRCm39) missense probably damaging 0.99
R7881:Col6a4 UTSW 9 105,957,497 (GRCm39) missense probably benign 0.14
R8157:Col6a4 UTSW 9 105,945,097 (GRCm39) missense possibly damaging 0.92
R8292:Col6a4 UTSW 9 105,954,076 (GRCm39) missense probably benign 0.01
R8309:Col6a4 UTSW 9 105,952,414 (GRCm39) missense probably benign 0.08
R8336:Col6a4 UTSW 9 105,952,528 (GRCm39) missense possibly damaging 0.65
R8359:Col6a4 UTSW 9 105,945,583 (GRCm39) missense probably benign 0.00
R8530:Col6a4 UTSW 9 105,957,704 (GRCm39) missense probably benign 0.31
R8556:Col6a4 UTSW 9 105,944,252 (GRCm39) missense probably damaging 0.96
R8832:Col6a4 UTSW 9 105,949,353 (GRCm39) missense probably benign
R9001:Col6a4 UTSW 9 105,944,370 (GRCm39) missense probably benign 0.26
R9009:Col6a4 UTSW 9 105,954,404 (GRCm39) missense probably benign 0.38
R9069:Col6a4 UTSW 9 105,952,138 (GRCm39) missense possibly damaging 0.85
R9155:Col6a4 UTSW 9 105,952,209 (GRCm39) missense probably benign
R9175:Col6a4 UTSW 9 105,957,560 (GRCm39) missense probably benign
R9176:Col6a4 UTSW 9 105,938,755 (GRCm39) missense probably damaging 1.00
R9295:Col6a4 UTSW 9 105,957,734 (GRCm39) missense probably damaging 1.00
R9298:Col6a4 UTSW 9 105,945,534 (GRCm39) missense probably damaging 0.96
R9424:Col6a4 UTSW 9 105,945,271 (GRCm39) missense probably benign 0.30
R9576:Col6a4 UTSW 9 105,945,271 (GRCm39) missense probably benign 0.30
RF022:Col6a4 UTSW 9 105,954,207 (GRCm39) missense probably damaging 0.99
X0025:Col6a4 UTSW 9 105,877,654 (GRCm39) missense probably damaging 0.99
Z1176:Col6a4 UTSW 9 105,878,069 (GRCm39) missense probably damaging 0.99
Z1176:Col6a4 UTSW 9 105,877,996 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCACGTTTTCCAGCGTCC -3'
(R):5'- GGCTTAAATCTGGCTCTCCC -3'

Sequencing Primer
(F):5'- TTCCAGCGTCCACTCCAGG -3'
(R):5'- AAATCTGGCTCTCCCTCATTAC -3'
Posted On 2022-04-18