Mutagenetix > Incidental Mutation

Incidental Mutation 'R9389:Dusp6'

710493

Institutional Source

Beutler Lab

Gene Symbol

Dusp6

Ensembl Gene

ENSMUSG00000019960

Gene Name

dual specificity phosphatase 6

Synonyms

PYST1, MKP-3, 1300019I03Rik, MKP3

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.406) question?

Stock #

R9389 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

99263231-99267489 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 99263977 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 96 (V96M)

Ref Sequence

ENSEMBL: ENSMUSP00000020118 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020118] [ENSMUST00000220291]

AlphaFold

Q9DBB1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020118
AA Change: V96M

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000020118
Gene: ENSMUSG00000019960
AA Change: V96M

Domain	Start	End	E-Value	Type
RHOD	20	145	3.06e-13	SMART
low complexity region	151	187	N/A	INTRINSIC
DSPc	206	346	5.51e-65	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000220291
AA Change: V96M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK2, is expressed in a variety of tissues with the highest levels in heart and pancreas, and unlike most other members of this family, is localized in the cytoplasm. Mutations in this gene have been associated with congenital hypogonadotropic hypogonadism. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous or heterozygous for a null mutation display partial penetrance of postnatal lethality, reduced body weight, and abnormal growth plate morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	C	T	6: 41,033,145	G85D	probably benign	Het
4931440F15Rik	A	G	11: 29,825,107	S117P	probably damaging	Het
Abcb1b	G	A	5: 8,825,614	V596I	probably benign	Het
Agtpbp1	A	T	13: 59,466,070	M1019K	probably damaging	Het
Arfgef3	A	G	10: 18,603,523	V1448A	probably damaging	Het
Baz1a	T	A	12: 54,916,823	E828D	probably damaging	Het
Ces1f	A	T	8: 93,269,972		probably null	Het
Cfap53	T	A	18: 74,299,343		probably null	Het
Col6a4	T	C	9: 106,000,784	Y1998C	probably damaging	Het
Col9a2	A	G	4: 121,054,751	T675A	probably benign	Het
Elmo1	T	G	13: 20,185,491	M22R	probably benign	Het
Gm19965	A	G	1: 116,821,836	N416D		Het
Gpr162	A	G	6: 124,861,394	Y98H	probably damaging	Het
Igfals	G	A	17: 24,881,626	V564I	probably benign	Het
Il4	C	T	11: 53,614,010	R76H	probably damaging	Het
Itgb1	T	A	8: 128,707,156	N50K	probably benign	Het
Itpr3	A	T	17: 27,095,925	Y682F	possibly damaging	Het
Jak3	C	T	8: 71,684,052	P668S	probably damaging	Het
Malrd1	A	T	2: 15,703,156	N932I	unknown	Het
Mast4	C	A	13: 103,333,930	R88L	probably benign	Het
Mfsd11	T	G	11: 116,873,335	S381A	probably benign	Het
Mrm3	A	G	11: 76,250,030	D288G	probably damaging	Het
Myg1	G	T	15: 102,336,937	V198F	probably damaging	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Npy6r	T	C	18: 44,275,692	I60T	probably damaging	Het
Olfr1109	A	T	2: 87,093,046	M117K	possibly damaging	Het
Olfr1308	G	T	2: 111,960,527	P182H	probably damaging	Het
Olfr1341	A	T	4: 118,710,156	M250L	probably benign	Het
Olfr177	C	T	16: 58,872,613	C179Y	probably damaging	Het
Olfr530	T	C	7: 140,373,017	T198A	probably benign	Het
Olfr811	G	A	10: 129,801,671	P285S	probably damaging	Het
Ovgp1	CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA	CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA	3: 105,986,525		probably benign	Het
Oxtr	C	A	6: 112,489,349	R150L	probably damaging	Het
Pappa	A	T	4: 65,180,888	Y548F	probably damaging	Het
Pip4k2a	T	C	2: 18,908,079	K73R	probably damaging	Het
Pla2g4f	T	A	2: 120,302,300	D685V	probably damaging	Het
Ppp1r35	T	A	5: 137,779,315	L81Q	probably damaging	Het
Ptprf	C	A	4: 118,236,039	A469S	probably benign	Het
Ranbp3l	T	A	15: 9,057,223	N322K	probably damaging	Het
Rev3l	T	A	10: 39,822,971	Y1155N	possibly damaging	Het
Rfesd	T	C	13: 76,003,012	Y96C	probably damaging	Het
Runx1	C	T	16: 92,613,680	V283I	possibly damaging	Het
Sema5b	A	C	16: 35,645,722	Q125P	probably damaging	Het
Spef2	A	T	15: 9,725,221	M150K	probably damaging	Het
Srcap	T	G	7: 127,542,283	L1745W	probably damaging	Het
Srgap2	A	G	1: 131,355,627	Y239H	probably damaging	Het
Svil	T	A	18: 5,090,811	H1304Q	possibly damaging	Het
Syne1	T	C	10: 5,229,193	D4427G	possibly damaging	Het
Tg	T	A	15: 66,689,324	M1065K	probably benign	Het
Tgm2	T	C	2: 158,117,896	T656A	probably benign	Het
Ttc37	A	G	13: 76,127,039	D403G	probably benign	Het
Ubr4	A	G	4: 139,425,924	K809E		Het
Vmn1r88	T	C	7: 13,178,619	S301P	probably damaging	Het
Wdr27	A	G	17: 14,891,718	V671A	possibly damaging	Het
Zbtb17	G	A	4: 141,465,820	V550I	possibly damaging	Het
Zeb2	A	T	2: 44,997,908	I379N	probably damaging	Het

Other mutations in Dusp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02272:Dusp6	APN	10	99266019	missense	probably damaging	1.00
IGL02687:Dusp6	APN	10	99266182	missense	probably damaging	0.97
IGL02996:Dusp6	APN	10	99264766	missense	possibly damaging	0.52
IGL03024:Dusp6	APN	10	99266294	missense	probably damaging	0.97
R1134:Dusp6	UTSW	10	99264954	missense	probably damaging	0.98
R1695:Dusp6	UTSW	10	99263693	start codon destroyed	probably null	0.99
R2078:Dusp6	UTSW	10	99263824	missense	probably damaging	1.00
R2899:Dusp6	UTSW	10	99263845	missense	probably damaging	1.00
R3162:Dusp6	UTSW	10	99264082	missense	probably damaging	1.00
R3162:Dusp6	UTSW	10	99264082	missense	probably damaging	1.00
R4413:Dusp6	UTSW	10	99263924	missense	probably damaging	1.00
R4501:Dusp6	UTSW	10	99264595	missense	probably benign	0.41
R5175:Dusp6	UTSW	10	99264002	missense	possibly damaging	0.91
R5381:Dusp6	UTSW	10	99266267	missense	possibly damaging	0.46
R5560:Dusp6	UTSW	10	99266241	missense	probably damaging	0.97
R5820:Dusp6	UTSW	10	99264002	missense	possibly damaging	0.91
R7359:Dusp6	UTSW	10	99264065	missense	probably benign	0.01
R7398:Dusp6	UTSW	10	99264878	missense	probably damaging	1.00
R8075:Dusp6	UTSW	10	99264948	missense	possibly damaging	0.63
R8491:Dusp6	UTSW	10	99266219	missense	possibly damaging	0.66
R8826:Dusp6	UTSW	10	99263607	start gained	probably benign
R9084:Dusp6	UTSW	10	99263830	missense	probably benign	0.13
R9125:Dusp6	UTSW	10	99266212	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TAGATACGCTCAGACCCGTG -3'
(R):5'- AACATTTTCCCCAGCCTGCAG -3'

Sequencing Primer
(F):5'- TCGGAAATGGCGATCTGC -3'
(R):5'- CCAGCCTGCAGTCCCAG -3'

Posted On

2022-04-18