Mutagenetix > Incidental Mutation

Incidental Mutation 'R9389:Agtpbp1'

710501

Institutional Source

Beutler Lab

Gene Symbol

Agtpbp1

Ensembl Gene

ENSMUSG00000021557

Gene Name

ATP/GTP binding protein 1

Synonyms

2310001G17Rik, Nna1, 1700020N17Rik, 4930445M19Rik, 2900054O13Rik, 5730402G09Rik

MMRRC Submission

Accession Numbers

Genbank: NM_023328; MGI: 2159437

Essential gene?

Possibly essential (E-score: 0.707) question?

Stock #

R9389 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59445742-59585227 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 59466070 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1019 (M1019K)

Ref Sequence

ENSEMBL: ENSMUSP00000022040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022040] [ENSMUST00000164215] [ENSMUST00000169745] [ENSMUST00000170555] [ENSMUST00000224397]

AlphaFold

Q641K1

Predicted Effect

probably damaging
Transcript: ENSMUST00000022040
AA Change: M1019K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022040
Gene: ENSMUSG00000021557
AA Change: M1019K

Domain	Start	End	E-Value	Type
low complexity region	362	391	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC
Pfam:Peptidase_M14	851	1099	1.7e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163149

SMART Domains

Protein: ENSMUSP00000126238
Gene: ENSMUSG00000021557

Domain	Start	End	E-Value	Type
low complexity region	250	279	N/A	INTRINSIC
low complexity region	477	491	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000164215
AA Change: M1019K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000130939
Gene: ENSMUSG00000021557
AA Change: M1019K

Domain	Start	End	E-Value	Type
low complexity region	362	391	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC
Pfam:Peptidase_M14	847	1123	1.2e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000169745

Predicted Effect

probably benign
Transcript: ENSMUST00000170555

SMART Domains

Protein: ENSMUSP00000128589
Gene: ENSMUSG00000021557

Domain	Start	End	E-Value	Type
Pfam:V-ATPase_H_N	34	309	2.4e-7	PFAM
low complexity region	362	391	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC
low complexity region	787	795	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224397
AA Change: M76K

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NNA1 is a zinc carboxypeptidase that contains nuclear localization signals and an ATP/GTP-binding motif that was initially cloned from regenerating spinal cord neurons of the mouse.[supplied by OMIM, Jul 2002]
PHENOTYPE: Homozygotes show moderate ataxia due to degeneration of Purkinje cells of the cerebellum. Also, there is gradual degeneration of retina photoreceptor cells, olfactory bulb mitral cells and some thalamic neurons. Males have abnormal sperm and are sterile. [provided by MGI curators]

Allele List at MGI

All alleles(17) : Gene trapped(6) Transgenic(1) Spontaneous(6) Chemically induced(4)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	C	T	6: 41,033,145	G85D	probably benign	Het
4931440F15Rik	A	G	11: 29,825,107	S117P	probably damaging	Het
Abcb1b	G	A	5: 8,825,614	V596I	probably benign	Het
Arfgef3	A	G	10: 18,603,523	V1448A	probably damaging	Het
Baz1a	T	A	12: 54,916,823	E828D	probably damaging	Het
Ces1f	A	T	8: 93,269,972		probably null	Het
Cfap53	T	A	18: 74,299,343		probably null	Het
Col6a4	T	C	9: 106,000,784	Y1998C	probably damaging	Het
Col9a2	A	G	4: 121,054,751	T675A	probably benign	Het
Dusp6	G	A	10: 99,263,977	V96M	possibly damaging	Het
Elmo1	T	G	13: 20,185,491	M22R	probably benign	Het
Gm19965	A	G	1: 116,821,836	N416D		Het
Gpr162	A	G	6: 124,861,394	Y98H	probably damaging	Het
Igfals	G	A	17: 24,881,626	V564I	probably benign	Het
Il4	C	T	11: 53,614,010	R76H	probably damaging	Het
Itgb1	T	A	8: 128,707,156	N50K	probably benign	Het
Itpr3	A	T	17: 27,095,925	Y682F	possibly damaging	Het
Jak3	C	T	8: 71,684,052	P668S	probably damaging	Het
Malrd1	A	T	2: 15,703,156	N932I	unknown	Het
Mast4	C	A	13: 103,333,930	R88L	probably benign	Het
Mfsd11	T	G	11: 116,873,335	S381A	probably benign	Het
Mrm3	A	G	11: 76,250,030	D288G	probably damaging	Het
Myg1	G	T	15: 102,336,937	V198F	probably damaging	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Npy6r	T	C	18: 44,275,692	I60T	probably damaging	Het
Olfr1109	A	T	2: 87,093,046	M117K	possibly damaging	Het
Olfr1308	G	T	2: 111,960,527	P182H	probably damaging	Het
Olfr1341	A	T	4: 118,710,156	M250L	probably benign	Het
Olfr177	C	T	16: 58,872,613	C179Y	probably damaging	Het
Olfr530	T	C	7: 140,373,017	T198A	probably benign	Het
Olfr811	G	A	10: 129,801,671	P285S	probably damaging	Het
Ovgp1	CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA	CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA	3: 105,986,525		probably benign	Het
Oxtr	C	A	6: 112,489,349	R150L	probably damaging	Het
Pappa	A	T	4: 65,180,888	Y548F	probably damaging	Het
Pip4k2a	T	C	2: 18,908,079	K73R	probably damaging	Het
Pla2g4f	T	A	2: 120,302,300	D685V	probably damaging	Het
Ppp1r35	T	A	5: 137,779,315	L81Q	probably damaging	Het
Ptprf	C	A	4: 118,236,039	A469S	probably benign	Het
Ranbp3l	T	A	15: 9,057,223	N322K	probably damaging	Het
Rev3l	T	A	10: 39,822,971	Y1155N	possibly damaging	Het
Rfesd	T	C	13: 76,003,012	Y96C	probably damaging	Het
Runx1	C	T	16: 92,613,680	V283I	possibly damaging	Het
Sema5b	A	C	16: 35,645,722	Q125P	probably damaging	Het
Spef2	A	T	15: 9,725,221	M150K	probably damaging	Het
Srcap	T	G	7: 127,542,283	L1745W	probably damaging	Het
Srgap2	A	G	1: 131,355,627	Y239H	probably damaging	Het
Svil	T	A	18: 5,090,811	H1304Q	possibly damaging	Het
Syne1	T	C	10: 5,229,193	D4427G	possibly damaging	Het
Tg	T	A	15: 66,689,324	M1065K	probably benign	Het
Tgm2	T	C	2: 158,117,896	T656A	probably benign	Het
Ttc37	A	G	13: 76,127,039	D403G	probably benign	Het
Ubr4	A	G	4: 139,425,924	K809E		Het
Vmn1r88	T	C	7: 13,178,619	S301P	probably damaging	Het
Wdr27	A	G	17: 14,891,718	V671A	possibly damaging	Het
Zbtb17	G	A	4: 141,465,820	V550I	possibly damaging	Het
Zeb2	A	T	2: 44,997,908	I379N	probably damaging	Het

Other mutations in Agtpbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00544:Agtpbp1	APN	13	59450172	missense	probably damaging	1.00
IGL00808:Agtpbp1	APN	13	59462094	missense	possibly damaging	0.84
IGL01298:Agtpbp1	APN	13	59504226	missense	possibly damaging	0.77
IGL01628:Agtpbp1	APN	13	59508063	splice site	probably benign
IGL01921:Agtpbp1	APN	13	59512483	missense	possibly damaging	0.71
IGL02189:Agtpbp1	APN	13	59500461	missense	probably benign	0.01
IGL02325:Agtpbp1	APN	13	59500489	missense	probably benign	0.01
IGL02700:Agtpbp1	APN	13	59528419	missense	probably damaging	1.00
IGL02821:Agtpbp1	APN	13	59482601	missense	possibly damaging	0.69
IGL03130:Agtpbp1	APN	13	59474589	missense	possibly damaging	0.73
IGL03167:Agtpbp1	APN	13	59532080	splice site	probably benign
IGL03218:Agtpbp1	APN	13	59500207	missense	possibly damaging	0.94
bobs	UTSW	13	59482571	missense	possibly damaging	0.53
drunk	UTSW	13	59512323	critical splice donor site	probably benign
gru	UTSW	13	59473746	missense	probably damaging	1.00
rio	UTSW	13	59525241	critical splice acceptor site	probably benign
shreds	UTSW	13	59462088	missense	probably damaging	1.00
Unfocused	UTSW	13	59462070	nonsense	probably null
wobble	UTSW	13	59474550	missense	probably damaging	1.00
R0025:Agtpbp1	UTSW	13	59500200	missense	probably benign	0.00
R0025:Agtpbp1	UTSW	13	59500200	missense	probably benign	0.00
R0276:Agtpbp1	UTSW	13	59462031	missense	possibly damaging	0.93
R0413:Agtpbp1	UTSW	13	59514152	missense	probably damaging	0.99
R0559:Agtpbp1	UTSW	13	59497000	missense	probably benign	0.32
R0848:Agtpbp1	UTSW	13	59533939	intron	probably benign
R0943:Agtpbp1	UTSW	13	59500602	missense	probably benign
R1196:Agtpbp1	UTSW	13	59450318	unclassified	probably benign
R1421:Agtpbp1	UTSW	13	59495575	missense	possibly damaging	0.86
R1531:Agtpbp1	UTSW	13	59500634	splice site	probably null
R1833:Agtpbp1	UTSW	13	59465983	critical splice donor site	probably null
R1864:Agtpbp1	UTSW	13	59450202	missense	possibly damaging	0.92
R1994:Agtpbp1	UTSW	13	59531058	missense	probably damaging	1.00
R1995:Agtpbp1	UTSW	13	59531058	missense	probably damaging	1.00
R2001:Agtpbp1	UTSW	13	59475803	frame shift	probably null
R2006:Agtpbp1	UTSW	13	59500321	missense	probably benign	0.00
R2397:Agtpbp1	UTSW	13	59474569	missense	probably benign	0.10
R2918:Agtpbp1	UTSW	13	59497015	missense	possibly damaging	0.90
R3873:Agtpbp1	UTSW	13	59460596	missense	possibly damaging	0.88
R3924:Agtpbp1	UTSW	13	59500407	missense	probably benign	0.01
R4649:Agtpbp1	UTSW	13	59528399	missense	possibly damaging	0.89
R4913:Agtpbp1	UTSW	13	59500072	missense	probably damaging	1.00
R4933:Agtpbp1	UTSW	13	59500572	missense	probably benign
R4969:Agtpbp1	UTSW	13	59500578	missense	probably benign
R5066:Agtpbp1	UTSW	13	59474550	missense	probably damaging	1.00
R5139:Agtpbp1	UTSW	13	59500213	missense	probably damaging	0.99
R5194:Agtpbp1	UTSW	13	59500639	missense	probably benign	0.19
R5269:Agtpbp1	UTSW	13	59473743	missense	probably damaging	1.00
R5352:Agtpbp1	UTSW	13	59473746	missense	probably damaging	1.00
R5558:Agtpbp1	UTSW	13	59482580	missense	probably benign	0.05
R5687:Agtpbp1	UTSW	13	59500515	missense	probably benign
R5824:Agtpbp1	UTSW	13	59466099	missense	probably damaging	1.00
R5979:Agtpbp1	UTSW	13	59534046	nonsense	probably null
R6109:Agtpbp1	UTSW	13	59473746	missense	probably damaging	1.00
R6264:Agtpbp1	UTSW	13	59450300	missense	possibly damaging	0.89
R6413:Agtpbp1	UTSW	13	59500020	missense	possibly damaging	0.90
R6498:Agtpbp1	UTSW	13	59477040	missense	possibly damaging	0.71
R6747:Agtpbp1	UTSW	13	59544353	splice site	probably null
R6950:Agtpbp1	UTSW	13	59450266	missense	probably benign	0.32
R7030:Agtpbp1	UTSW	13	59504294	missense	probably damaging	1.00
R7180:Agtpbp1	UTSW	13	59466038	missense	probably benign	0.11
R7196:Agtpbp1	UTSW	13	59533180	missense	possibly damaging	0.83
R7535:Agtpbp1	UTSW	13	59504253	missense	probably benign
R7683:Agtpbp1	UTSW	13	59512498	missense	probably damaging	1.00
R7713:Agtpbp1	UTSW	13	59514152	missense	probably damaging	0.99
R8081:Agtpbp1	UTSW	13	59528407	nonsense	probably null
R8210:Agtpbp1	UTSW	13	59482571	missense	possibly damaging	0.53
R8861:Agtpbp1	UTSW	13	59495473	missense	probably damaging	1.00
R9163:Agtpbp1	UTSW	13	59462070	nonsense	probably null
R9199:Agtpbp1	UTSW	13	59465994	missense	probably benign	0.00
R9414:Agtpbp1	UTSW	13	59462088	missense	probably damaging	1.00
R9435:Agtpbp1	UTSW	13	59474615	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- TCGAAGCAAAAGCTCTGAGAC -3'
(R):5'- TTAGAACTCAAGCGTGCGGC -3'

Sequencing Primer
(F):5'- GTAAATGTCACGTCTGACCAAGTCG -3'
(R):5'- TGCGGCTGCCTTCACTCAG -3'

Posted On

2022-04-18