Incidental Mutation 'R9389:Ttc37'
ID 710503
Institutional Source Beutler Lab
Gene Symbol Ttc37
Ensembl Gene ENSMUSG00000033991
Gene Name tetratricopeptide repeat domain 37
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.470) question?
Stock # R9389 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 76098734-76190316 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 76127039 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 403 (D403G)
Ref Sequence ENSEMBL: ENSMUSP00000089045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091466] [ENSMUST00000224386]
AlphaFold F8VPK0
Predicted Effect probably benign
Transcript: ENSMUST00000091466
AA Change: D403G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000089045
Gene: ENSMUSG00000033991
AA Change: D403G

DomainStartEndE-ValueType
TPR 6 39 2.92e1 SMART
TPR 40 73 1.1e-1 SMART
TPR 272 305 9.45e0 SMART
TPR 306 339 8.9e-2 SMART
SEL1 420 451 1.45e2 SMART
TPR 420 453 2.55e-2 SMART
SEL1 454 490 1.15e1 SMART
TPR 454 492 2.84e1 SMART
TPR 493 527 1.92e1 SMART
TPR 564 597 7.34e-3 SMART
TPR 598 631 1.81e-2 SMART
TPR 632 665 2.43e1 SMART
low complexity region 728 739 N/A INTRINSIC
SEL1 861 892 3.58e1 SMART
TPR 861 894 2.14e-4 SMART
TPR 980 1013 1.56e1 SMART
Blast:TPR 1051 1084 7e-11 BLAST
Blast:TPR 1088 1121 7e-10 BLAST
TPR 1399 1432 4.31e0 SMART
low complexity region 1438 1450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224386
AA Change: D403G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with twenty tetratricopeptide (TPR) repeats. Tetratricopeptide repeat containing motifs are found in a variety of proteins and may mediate protein-protein interactions and chaperone activity. Mutations in this gene are associated with trichohepatoenteric syndrome. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik C T 6: 41,033,145 G85D probably benign Het
4931440F15Rik A G 11: 29,825,107 S117P probably damaging Het
Abcb1b G A 5: 8,825,614 V596I probably benign Het
Agtpbp1 A T 13: 59,466,070 M1019K probably damaging Het
Arfgef3 A G 10: 18,603,523 V1448A probably damaging Het
Baz1a T A 12: 54,916,823 E828D probably damaging Het
Ces1f A T 8: 93,269,972 probably null Het
Cfap53 T A 18: 74,299,343 probably null Het
Col6a4 T C 9: 106,000,784 Y1998C probably damaging Het
Col9a2 A G 4: 121,054,751 T675A probably benign Het
Dusp6 G A 10: 99,263,977 V96M possibly damaging Het
Elmo1 T G 13: 20,185,491 M22R probably benign Het
Gm19965 A G 1: 116,821,836 N416D Het
Gpr162 A G 6: 124,861,394 Y98H probably damaging Het
Igfals G A 17: 24,881,626 V564I probably benign Het
Il4 C T 11: 53,614,010 R76H probably damaging Het
Itgb1 T A 8: 128,707,156 N50K probably benign Het
Itpr3 A T 17: 27,095,925 Y682F possibly damaging Het
Jak3 C T 8: 71,684,052 P668S probably damaging Het
Malrd1 A T 2: 15,703,156 N932I unknown Het
Mast4 C A 13: 103,333,930 R88L probably benign Het
Mfsd11 T G 11: 116,873,335 S381A probably benign Het
Mrm3 A G 11: 76,250,030 D288G probably damaging Het
Myg1 G T 15: 102,336,937 V198F probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Npy6r T C 18: 44,275,692 I60T probably damaging Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr1308 G T 2: 111,960,527 P182H probably damaging Het
Olfr1341 A T 4: 118,710,156 M250L probably benign Het
Olfr177 C T 16: 58,872,613 C179Y probably damaging Het
Olfr530 T C 7: 140,373,017 T198A probably benign Het
Olfr811 G A 10: 129,801,671 P285S probably damaging Het
Ovgp1 CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA 3: 105,986,525 probably benign Het
Oxtr C A 6: 112,489,349 R150L probably damaging Het
Pappa A T 4: 65,180,888 Y548F probably damaging Het
Pip4k2a T C 2: 18,908,079 K73R probably damaging Het
Pla2g4f T A 2: 120,302,300 D685V probably damaging Het
Ppp1r35 T A 5: 137,779,315 L81Q probably damaging Het
Ptprf C A 4: 118,236,039 A469S probably benign Het
Ranbp3l T A 15: 9,057,223 N322K probably damaging Het
Rev3l T A 10: 39,822,971 Y1155N possibly damaging Het
Rfesd T C 13: 76,003,012 Y96C probably damaging Het
Runx1 C T 16: 92,613,680 V283I possibly damaging Het
Sema5b A C 16: 35,645,722 Q125P probably damaging Het
Spef2 A T 15: 9,725,221 M150K probably damaging Het
Srcap T G 7: 127,542,283 L1745W probably damaging Het
Srgap2 A G 1: 131,355,627 Y239H probably damaging Het
Svil T A 18: 5,090,811 H1304Q possibly damaging Het
Syne1 T C 10: 5,229,193 D4427G possibly damaging Het
Tg T A 15: 66,689,324 M1065K probably benign Het
Tgm2 T C 2: 158,117,896 T656A probably benign Het
Ubr4 A G 4: 139,425,924 K809E Het
Vmn1r88 T C 7: 13,178,619 S301P probably damaging Het
Wdr27 A G 17: 14,891,718 V671A possibly damaging Het
Zbtb17 G A 4: 141,465,820 V550I possibly damaging Het
Zeb2 A T 2: 44,997,908 I379N probably damaging Het
Other mutations in Ttc37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Ttc37 APN 13 76143278 critical splice donor site probably null
IGL00650:Ttc37 APN 13 76127507 missense possibly damaging 0.89
IGL00838:Ttc37 APN 13 76134791 missense probably damaging 0.99
IGL00958:Ttc37 APN 13 76122745 missense probably damaging 0.98
IGL01011:Ttc37 APN 13 76122665 missense probably damaging 0.97
IGL01062:Ttc37 APN 13 76155462 nonsense probably null
IGL01319:Ttc37 APN 13 76129379 missense probably benign 0.29
IGL01697:Ttc37 APN 13 76128733 missense probably benign 0.01
IGL02061:Ttc37 APN 13 76129541 critical splice donor site probably null
IGL02184:Ttc37 APN 13 76111691 missense probably damaging 1.00
IGL02309:Ttc37 APN 13 76127047 missense possibly damaging 0.90
IGL03230:Ttc37 APN 13 76155647 splice site probably benign
IGL03354:Ttc37 APN 13 76182822 missense possibly damaging 0.71
caviar UTSW 13 76147767 missense possibly damaging 0.54
gourmet UTSW 13 76150519 missense probably damaging 1.00
tartare UTSW 13 76185179 missense probably damaging 0.96
R0501:Ttc37 UTSW 13 76147806 missense probably benign
R0628:Ttc37 UTSW 13 76150729 missense possibly damaging 0.89
R0711:Ttc37 UTSW 13 76182891 missense probably damaging 1.00
R0928:Ttc37 UTSW 13 76113592 missense probably damaging 1.00
R1402:Ttc37 UTSW 13 76131414 missense probably damaging 1.00
R1402:Ttc37 UTSW 13 76131414 missense probably damaging 1.00
R1524:Ttc37 UTSW 13 76138372 missense probably benign 0.01
R1628:Ttc37 UTSW 13 76111791 missense possibly damaging 0.75
R1702:Ttc37 UTSW 13 76122743 missense possibly damaging 0.66
R1750:Ttc37 UTSW 13 76140601 missense possibly damaging 0.89
R1822:Ttc37 UTSW 13 76130288 missense probably benign 0.35
R1885:Ttc37 UTSW 13 76113047 missense probably benign 0.00
R1885:Ttc37 UTSW 13 76130235 missense probably benign 0.11
R1923:Ttc37 UTSW 13 76134770 missense probably damaging 1.00
R1978:Ttc37 UTSW 13 76134815 missense probably benign 0.00
R2040:Ttc37 UTSW 13 76180103 missense probably damaging 1.00
R2136:Ttc37 UTSW 13 76173354 missense possibly damaging 0.87
R2268:Ttc37 UTSW 13 76112274 unclassified probably benign
R2483:Ttc37 UTSW 13 76182867 missense probably damaging 1.00
R2988:Ttc37 UTSW 13 76155689 missense probably benign 0.11
R3701:Ttc37 UTSW 13 76113679 missense probably benign
R3951:Ttc37 UTSW 13 76130219 missense probably damaging 1.00
R4405:Ttc37 UTSW 13 76155665 missense probably damaging 0.97
R4411:Ttc37 UTSW 13 76127504 missense possibly damaging 0.89
R4957:Ttc37 UTSW 13 76185113 splice site probably null
R4960:Ttc37 UTSW 13 76185156 missense possibly damaging 0.95
R4993:Ttc37 UTSW 13 76182936 missense probably damaging 0.96
R5206:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5208:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5302:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5305:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5306:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5579:Ttc37 UTSW 13 76185200 missense probably damaging 1.00
R5618:Ttc37 UTSW 13 76173426 missense probably benign
R5726:Ttc37 UTSW 13 76118347 missense probably damaging 1.00
R5813:Ttc37 UTSW 13 76155733 missense probably benign 0.05
R5899:Ttc37 UTSW 13 76111819 splice site probably null
R6146:Ttc37 UTSW 13 76185240 missense probably damaging 1.00
R6224:Ttc37 UTSW 13 76118291 missense probably benign 0.02
R6286:Ttc37 UTSW 13 76143240 missense probably damaging 1.00
R6402:Ttc37 UTSW 13 76135270 missense probably benign 0.05
R6561:Ttc37 UTSW 13 76150519 missense probably damaging 1.00
R6808:Ttc37 UTSW 13 76185179 missense probably damaging 0.96
R7054:Ttc37 UTSW 13 76134960 missense probably damaging 1.00
R7261:Ttc37 UTSW 13 76113579 missense probably benign 0.30
R7267:Ttc37 UTSW 13 76180077 missense probably benign 0.15
R7348:Ttc37 UTSW 13 76182884 missense possibly damaging 0.82
R7384:Ttc37 UTSW 13 76150735 missense possibly damaging 0.53
R7404:Ttc37 UTSW 13 76148747 nonsense probably null
R7421:Ttc37 UTSW 13 76148825 missense probably benign 0.12
R7546:Ttc37 UTSW 13 76134835 missense probably damaging 1.00
R7771:Ttc37 UTSW 13 76135030 missense probably benign 0.21
R7960:Ttc37 UTSW 13 76112199 missense probably benign 0.03
R8125:Ttc37 UTSW 13 76130327 critical splice donor site probably null
R8136:Ttc37 UTSW 13 76113103 missense probably benign 0.00
R8680:Ttc37 UTSW 13 76155468 missense probably benign 0.01
R8697:Ttc37 UTSW 13 76180155 missense probably damaging 1.00
R8867:Ttc37 UTSW 13 76131309 missense probably damaging 0.99
R8872:Ttc37 UTSW 13 76185207 missense probably damaging 1.00
R8876:Ttc37 UTSW 13 76175284 missense probably benign 0.12
R8912:Ttc37 UTSW 13 76157242 splice site probably benign
R9174:Ttc37 UTSW 13 76147774 missense probably benign 0.00
R9334:Ttc37 UTSW 13 76132957 missense possibly damaging 0.65
R9422:Ttc37 UTSW 13 76130328 splice site probably benign
R9443:Ttc37 UTSW 13 76118169 missense probably benign 0.01
R9545:Ttc37 UTSW 13 76111713 missense probably damaging 1.00
R9596:Ttc37 UTSW 13 76182849 missense possibly damaging 0.64
X0067:Ttc37 UTSW 13 76132933 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGACTATGACGAAATTCTGTAAGTC -3'
(R):5'- ATACCTGTCAACTCCATGGCC -3'

Sequencing Primer
(F):5'- CGAAATTCTGTAAGTCCTTGTTTTTC -3'
(R):5'- GAGTCCCAAGTTCAATTCTCAGC -3'
Posted On 2022-04-18