Mutagenetix > Incidental Mutation

Incidental Mutation 'R9389:Spef2'

710506

Institutional Source

Beutler Lab

Gene Symbol

Spef2

Ensembl Gene

ENSMUSG00000072663

Gene Name

sperm flagellar 2

Synonyms

C230086A09Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.074) question?

Stock #

R9389 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

9578193-9748868 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 9725221 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 150 (M150K)

Ref Sequence

ENSEMBL: ENSMUSP00000035762 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041840] [ENSMUST00000159093] [ENSMUST00000159368] [ENSMUST00000160236] [ENSMUST00000162780] [ENSMUST00000208854]

AlphaFold

Q8C9J3

Predicted Effect

probably damaging
Transcript: ENSMUST00000041840
AA Change: M150K

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000035762
Gene: ENSMUSG00000072663
AA Change: M150K

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	161	2.8e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	829	5.9e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000159093
AA Change: M207K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124891
Gene: ENSMUSG00000072663
AA Change: M207K

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	166	3.5e-57	PFAM
coiled coil region	167	205	N/A	INTRINSIC
low complexity region	208	220	N/A	INTRINSIC
coiled coil region	228	260	N/A	INTRINSIC
low complexity region	304	313	N/A	INTRINSIC
coiled coil region	369	402	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000159368
AA Change: M150K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124723
Gene: ENSMUSG00000072663
AA Change: M150K

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	162	1.4e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000160236
AA Change: M150K

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: M150K

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	160	4.6e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	787	3.7e-10	PFAM
low complexity region	819	855	N/A	INTRINSIC
low complexity region	899	907	N/A	INTRINSIC
low complexity region	1201	1225	N/A	INTRINSIC
low complexity region	1254	1268	N/A	INTRINSIC
low complexity region	1349	1359	N/A	INTRINSIC
SCOP:d1rec__	1368	1520	3e-3	SMART
low complexity region	1595	1614	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000162780
AA Change: M207K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124393
Gene: ENSMUSG00000072663
AA Change: M207K

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	164	1.1e-57	PFAM
coiled coil region	167	205	N/A	INTRINSIC
low complexity region	208	220	N/A	INTRINSIC
coiled coil region	228	260	N/A	INTRINSIC
low complexity region	304	313	N/A	INTRINSIC
coiled coil region	369	402	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000208854
AA Change: M150K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	C	T	6: 41,033,145	G85D	probably benign	Het
4931440F15Rik	A	G	11: 29,825,107	S117P	probably damaging	Het
Abcb1b	G	A	5: 8,825,614	V596I	probably benign	Het
Agtpbp1	A	T	13: 59,466,070	M1019K	probably damaging	Het
Arfgef3	A	G	10: 18,603,523	V1448A	probably damaging	Het
Baz1a	T	A	12: 54,916,823	E828D	probably damaging	Het
Ces1f	A	T	8: 93,269,972		probably null	Het
Cfap53	T	A	18: 74,299,343		probably null	Het
Col6a4	T	C	9: 106,000,784	Y1998C	probably damaging	Het
Col9a2	A	G	4: 121,054,751	T675A	probably benign	Het
Dusp6	G	A	10: 99,263,977	V96M	possibly damaging	Het
Elmo1	T	G	13: 20,185,491	M22R	probably benign	Het
Gm19965	A	G	1: 116,821,836	N416D		Het
Gpr162	A	G	6: 124,861,394	Y98H	probably damaging	Het
Igfals	G	A	17: 24,881,626	V564I	probably benign	Het
Il4	C	T	11: 53,614,010	R76H	probably damaging	Het
Itgb1	T	A	8: 128,707,156	N50K	probably benign	Het
Itpr3	A	T	17: 27,095,925	Y682F	possibly damaging	Het
Jak3	C	T	8: 71,684,052	P668S	probably damaging	Het
Malrd1	A	T	2: 15,703,156	N932I	unknown	Het
Mast4	C	A	13: 103,333,930	R88L	probably benign	Het
Mfsd11	T	G	11: 116,873,335	S381A	probably benign	Het
Mrm3	A	G	11: 76,250,030	D288G	probably damaging	Het
Myg1	G	T	15: 102,336,937	V198F	probably damaging	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Npy6r	T	C	18: 44,275,692	I60T	probably damaging	Het
Olfr1109	A	T	2: 87,093,046	M117K	possibly damaging	Het
Olfr1308	G	T	2: 111,960,527	P182H	probably damaging	Het
Olfr1341	A	T	4: 118,710,156	M250L	probably benign	Het
Olfr177	C	T	16: 58,872,613	C179Y	probably damaging	Het
Olfr530	T	C	7: 140,373,017	T198A	probably benign	Het
Olfr811	G	A	10: 129,801,671	P285S	probably damaging	Het
Ovgp1	CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA	CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA	3: 105,986,525		probably benign	Het
Oxtr	C	A	6: 112,489,349	R150L	probably damaging	Het
Pappa	A	T	4: 65,180,888	Y548F	probably damaging	Het
Pip4k2a	T	C	2: 18,908,079	K73R	probably damaging	Het
Pla2g4f	T	A	2: 120,302,300	D685V	probably damaging	Het
Ppp1r35	T	A	5: 137,779,315	L81Q	probably damaging	Het
Ptprf	C	A	4: 118,236,039	A469S	probably benign	Het
Ranbp3l	T	A	15: 9,057,223	N322K	probably damaging	Het
Rev3l	T	A	10: 39,822,971	Y1155N	possibly damaging	Het
Rfesd	T	C	13: 76,003,012	Y96C	probably damaging	Het
Runx1	C	T	16: 92,613,680	V283I	possibly damaging	Het
Sema5b	A	C	16: 35,645,722	Q125P	probably damaging	Het
Srcap	T	G	7: 127,542,283	L1745W	probably damaging	Het
Srgap2	A	G	1: 131,355,627	Y239H	probably damaging	Het
Svil	T	A	18: 5,090,811	H1304Q	possibly damaging	Het
Syne1	T	C	10: 5,229,193	D4427G	possibly damaging	Het
Tg	T	A	15: 66,689,324	M1065K	probably benign	Het
Tgm2	T	C	2: 158,117,896	T656A	probably benign	Het
Ttc37	A	G	13: 76,127,039	D403G	probably benign	Het
Ubr4	A	G	4: 139,425,924	K809E		Het
Vmn1r88	T	C	7: 13,178,619	S301P	probably damaging	Het
Wdr27	A	G	17: 14,891,718	V671A	possibly damaging	Het
Zbtb17	G	A	4: 141,465,820	V550I	possibly damaging	Het
Zeb2	A	T	2: 44,997,908	I379N	probably damaging	Het

Other mutations in Spef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Spef2	APN	15	9740535	missense	probably damaging	1.00
IGL00886:Spef2	APN	15	9663095	missense	probably damaging	1.00
IGL01409:Spef2	APN	15	9716413	missense	probably damaging	1.00
IGL01413:Spef2	APN	15	9676290	missense	probably benign	0.16
IGL01474:Spef2	APN	15	9663158	missense	probably benign	0.00
IGL01603:Spef2	APN	15	9704380	missense	probably damaging	0.99
IGL02320:Spef2	APN	15	9717576	missense	probably damaging	0.99
IGL02570:Spef2	APN	15	9717498	nonsense	probably null
IGL02605:Spef2	APN	15	9725152	missense	probably damaging	0.99
IGL02890:Spef2	APN	15	9748767	start codon destroyed	probably null	1.00
IGL02904:Spef2	APN	15	9679346	missense	probably damaging	1.00
IGL02942:Spef2	APN	15	9668874	missense	possibly damaging	0.71
IGL02953:Spef2	APN	15	9713243	missense	possibly damaging	0.82
IGL02965:Spef2	APN	15	9725106	splice site	probably benign
IGL03263:Spef2	APN	15	9667219	missense	possibly damaging	0.72
IGL03302:Spef2	APN	15	9676380	missense	probably benign	0.01
R0101:Spef2	UTSW	15	9713108	missense	probably damaging	1.00
R0101:Spef2	UTSW	15	9713108	missense	probably damaging	1.00
R0183:Spef2	UTSW	15	9716359	missense	possibly damaging	0.70
R0386:Spef2	UTSW	15	9584062	missense	probably damaging	1.00
R0511:Spef2	UTSW	15	9583984	critical splice donor site	probably null
R0617:Spef2	UTSW	15	9592758	missense	probably damaging	1.00
R0655:Spef2	UTSW	15	9626131	missense	possibly damaging	0.96
R0829:Spef2	UTSW	15	9687813	missense	probably benign	0.10
R0908:Spef2	UTSW	15	9614195	splice site	probably null
R0939:Spef2	UTSW	15	9704550	splice site	probably null
R0973:Spef2	UTSW	15	9716396	missense	probably damaging	1.00
R1371:Spef2	UTSW	15	9725108	splice site	probably benign
R1392:Spef2	UTSW	15	9647263	missense	probably benign	0.15
R1392:Spef2	UTSW	15	9647263	missense	probably benign	0.15
R1428:Spef2	UTSW	15	9596707	unclassified	probably benign
R1518:Spef2	UTSW	15	9667230	missense	probably damaging	1.00
R1585:Spef2	UTSW	15	9596574	missense	probably damaging	1.00
R1654:Spef2	UTSW	15	9634652	missense	probably damaging	0.99
R1723:Spef2	UTSW	15	9614209	missense	probably damaging	1.00
R1757:Spef2	UTSW	15	9717482	missense	probably damaging	1.00
R1812:Spef2	UTSW	15	9679349	missense	probably damaging	1.00
R1817:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1818:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1873:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9597401	missense	possibly damaging	0.78
R1897:Spef2	UTSW	15	9729654	nonsense	probably null
R1901:Spef2	UTSW	15	9607377	missense	probably damaging	1.00
R1902:Spef2	UTSW	15	9607377	missense	probably damaging	1.00
R1943:Spef2	UTSW	15	9663194	missense	possibly damaging	0.76
R1968:Spef2	UTSW	15	9609516	missense	probably damaging	1.00
R1973:Spef2	UTSW	15	9663066	makesense	probably null
R1998:Spef2	UTSW	15	9668903	critical splice acceptor site	probably null
R1999:Spef2	UTSW	15	9668903	critical splice acceptor site	probably null
R2008:Spef2	UTSW	15	9713185	missense	possibly damaging	0.95
R2111:Spef2	UTSW	15	9589573	missense	probably damaging	1.00
R2127:Spef2	UTSW	15	9729661	missense	possibly damaging	0.53
R2405:Spef2	UTSW	15	9626034	nonsense	probably null
R2517:Spef2	UTSW	15	9725197	missense	possibly damaging	0.93
R2889:Spef2	UTSW	15	9630613	missense	probably damaging	0.99
R2988:Spef2	UTSW	15	9682623	missense	probably benign	0.43
R3792:Spef2	UTSW	15	9704536	missense	probably damaging	1.00
R4154:Spef2	UTSW	15	9626021	missense	probably benign	0.13
R4159:Spef2	UTSW	15	9676321	missense	probably damaging	1.00
R4199:Spef2	UTSW	15	9667280	missense	probably damaging	1.00
R4320:Spef2	UTSW	15	9679343	missense	possibly damaging	0.93
R4321:Spef2	UTSW	15	9679343	missense	possibly damaging	0.93
R4568:Spef2	UTSW	15	9647217	missense	probably damaging	1.00
R4625:Spef2	UTSW	15	9647438	missense	probably damaging	1.00
R4669:Spef2	UTSW	15	9676373	missense	probably benign	0.42
R4684:Spef2	UTSW	15	9647490	missense	probably benign	0.44
R4761:Spef2	UTSW	15	9652954	missense	probably damaging	1.00
R4839:Spef2	UTSW	15	9713178	nonsense	probably null
R5004:Spef2	UTSW	15	9578327	missense	probably benign	0.02
R5157:Spef2	UTSW	15	9668791	nonsense	probably null
R5230:Spef2	UTSW	15	9667230	missense	possibly damaging	0.62
R5315:Spef2	UTSW	15	9596691	missense	probably damaging	0.98
R5400:Spef2	UTSW	15	9614281	missense	probably damaging	1.00
R5591:Spef2	UTSW	15	9583836	missense	probably benign	0.02
R5599:Spef2	UTSW	15	9729703	missense	possibly damaging	0.53
R5605:Spef2	UTSW	15	9609520	missense	probably damaging	0.96
R5787:Spef2	UTSW	15	9748726	missense	possibly damaging	0.91
R5939:Spef2	UTSW	15	9614215	missense	probably benign	0.16
R6177:Spef2	UTSW	15	9727532	missense	possibly damaging	0.89
R6641:Spef2	UTSW	15	9625973	missense	probably damaging	1.00
R6665:Spef2	UTSW	15	9600518	critical splice donor site	probably null
R6944:Spef2	UTSW	15	9592749	missense	probably damaging	1.00
R6956:Spef2	UTSW	15	9684935	missense	probably damaging	1.00
R6968:Spef2	UTSW	15	9597340	missense	probably benign	0.02
R7089:Spef2	UTSW	15	9725171	missense	probably damaging	1.00
R7117:Spef2	UTSW	15	9729838	missense	probably damaging	1.00
R7161:Spef2	UTSW	15	9717603	missense	probably benign	0.29
R7223:Spef2	UTSW	15	9601640	missense	unknown
R7263:Spef2	UTSW	15	9653012	splice site	probably null
R7270:Spef2	UTSW	15	9599980	critical splice donor site	probably null
R7303:Spef2	UTSW	15	9647490	missense	possibly damaging	0.92
R7369:Spef2	UTSW	15	9584207	missense	probably benign	0.02
R7464:Spef2	UTSW	15	9740585	missense	probably benign	0.23
R7498:Spef2	UTSW	15	9727539	missense	probably benign
R7587:Spef2	UTSW	15	9713219	missense	probably damaging	1.00
R7748:Spef2	UTSW	15	9652945	missense	probably damaging	0.98
R7772:Spef2	UTSW	15	9704481	missense	probably damaging	0.99
R7838:Spef2	UTSW	15	9609551	missense	possibly damaging	0.53
R7854:Spef2	UTSW	15	9596644	missense	possibly damaging	0.77
R7855:Spef2	UTSW	15	9687895	missense	possibly damaging	0.53
R7889:Spef2	UTSW	15	9717563	missense	probably damaging	1.00
R7943:Spef2	UTSW	15	9601085	missense	unknown
R8105:Spef2	UTSW	15	9682662	missense	probably benign	0.06
R8151:Spef2	UTSW	15	9601512	missense	unknown
R8296:Spef2	UTSW	15	9727543	missense	probably benign	0.06
R8393:Spef2	UTSW	15	9676529	missense	probably benign	0.27
R8405:Spef2	UTSW	15	9612557	missense	probably benign	0.00
R8552:Spef2	UTSW	15	9600679	intron	probably benign
R8691:Spef2	UTSW	15	9601919	nonsense	probably null
R8751:Spef2	UTSW	15	9729637	nonsense	probably null
R8847:Spef2	UTSW	15	9668827	missense	probably benign
R8864:Spef2	UTSW	15	9599747	missense	unknown
R8868:Spef2	UTSW	15	9729661	missense	possibly damaging	0.53
R8916:Spef2	UTSW	15	9725180	nonsense	probably null
R8935:Spef2	UTSW	15	9607350	missense	probably damaging	0.98
R8961:Spef2	UTSW	15	9647328	missense	possibly damaging	0.92
R8978:Spef2	UTSW	15	9725177	missense	possibly damaging	0.81
R9062:Spef2	UTSW	15	9601631	missense	unknown
R9076:Spef2	UTSW	15	9653005	missense	probably benign	0.13
R9149:Spef2	UTSW	15	9717482	missense	probably damaging	1.00
R9162:Spef2	UTSW	15	9601931	missense	unknown
R9216:Spef2	UTSW	15	9647525	missense	probably damaging	1.00
R9240:Spef2	UTSW	15	9578315	nonsense	probably null
R9278:Spef2	UTSW	15	9727409	critical splice donor site	probably null
R9341:Spef2	UTSW	15	9713104	missense	probably damaging	1.00
R9343:Spef2	UTSW	15	9713104	missense	probably damaging	1.00
R9476:Spef2	UTSW	15	9713117	missense	probably damaging	1.00
R9510:Spef2	UTSW	15	9713117	missense	probably damaging	1.00
R9537:Spef2	UTSW	15	9601799	missense	unknown
R9575:Spef2	UTSW	15	9596586	missense	probably damaging	1.00
R9597:Spef2	UTSW	15	9599811	missense	unknown
R9765:Spef2	UTSW	15	9601859	missense	unknown
X0025:Spef2	UTSW	15	9596622	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTCAAGCTACATCCTGCTAC -3'
(R):5'- CACCTTGTGCATTTATTAATCGCG -3'

Sequencing Primer
(F):5'- ACTAAGCAAACAAGAGTTTTGAAAAG -3'
(R):5'- CGCGAAGTTCTGAAATTTTCAACAG -3'

Posted On

2022-04-18