Incidental Mutation 'R9389:Or5k14'
ID 710510
Institutional Source Beutler Lab
Gene Symbol Or5k14
Ensembl Gene ENSMUSG00000063137
Gene Name olfactory receptor family 5 subfamily K member 14
Synonyms Olfr176, GA_x54KRFPKG5P-55091371-55090442, MOR184-8, GA_x54KRFPKG5P-55043245-55042289, Olfr177, MOR184-7
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.132) question?
Stock # R9389 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 58689766-58693511 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 58692976 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 179 (C179Y)
Ref Sequence ENSEMBL: ENSMUSP00000150269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072853] [ENSMUST00000217377]
AlphaFold E9Q7W1
Predicted Effect probably damaging
Transcript: ENSMUST00000072853
AA Change: C179Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072631
Gene: ENSMUSG00000063137
AA Change: C179Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.7e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 254 8.3e-6 PFAM
Pfam:7tm_1 41 290 1.2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217377
AA Change: C179Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,875,614 (GRCm39) V596I probably benign Het
Agtpbp1 A T 13: 59,613,884 (GRCm39) M1019K probably damaging Het
Arfgef3 A G 10: 18,479,271 (GRCm39) V1448A probably damaging Het
Baz1a T A 12: 54,963,608 (GRCm39) E828D probably damaging Het
Ces1f A T 8: 93,996,600 (GRCm39) probably null Het
Cfap53 T A 18: 74,432,414 (GRCm39) probably null Het
Col6a4 T C 9: 105,877,983 (GRCm39) Y1998C probably damaging Het
Col9a2 A G 4: 120,911,948 (GRCm39) T675A probably benign Het
Dusp6 G A 10: 99,099,839 (GRCm39) V96M possibly damaging Het
Elmo1 T G 13: 20,369,661 (GRCm39) M22R probably benign Het
Fem1al A G 11: 29,775,107 (GRCm39) S117P probably damaging Het
Gm19965 A G 1: 116,749,566 (GRCm39) N416D Het
Gpr162 A G 6: 124,838,357 (GRCm39) Y98H probably damaging Het
Igfals G A 17: 25,100,600 (GRCm39) V564I probably benign Het
Il4 C T 11: 53,504,837 (GRCm39) R76H probably damaging Het
Itgb1 T A 8: 129,433,637 (GRCm39) N50K probably benign Het
Itpr3 A T 17: 27,314,899 (GRCm39) Y682F possibly damaging Het
Jak3 C T 8: 72,136,696 (GRCm39) P668S probably damaging Het
Malrd1 A T 2: 15,707,967 (GRCm39) N932I unknown Het
Mast4 C A 13: 103,470,438 (GRCm39) R88L probably benign Het
Mfsd11 T G 11: 116,764,161 (GRCm39) S381A probably benign Het
Mrm3 A G 11: 76,140,856 (GRCm39) D288G probably damaging Het
Myg1 G T 15: 102,245,372 (GRCm39) V198F probably damaging Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Npy6r T C 18: 44,408,759 (GRCm39) I60T probably damaging Het
Or12j3 T C 7: 139,952,930 (GRCm39) T198A probably benign Het
Or13p3 A T 4: 118,567,353 (GRCm39) M250L probably benign Het
Or4f57 G T 2: 111,790,872 (GRCm39) P182H probably damaging Het
Or5aq6 A T 2: 86,923,390 (GRCm39) M117K possibly damaging Het
Or6c215 G A 10: 129,637,540 (GRCm39) P285S probably damaging Het
Ovgp1 CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA 3: 105,893,841 (GRCm39) probably benign Het
Oxtr C A 6: 112,466,310 (GRCm39) R150L probably damaging Het
Pappa A T 4: 65,099,125 (GRCm39) Y548F probably damaging Het
Pip4k2a T C 2: 18,912,890 (GRCm39) K73R probably damaging Het
Pla2g4f T A 2: 120,132,781 (GRCm39) D685V probably damaging Het
Ppp1r35 T A 5: 137,777,577 (GRCm39) L81Q probably damaging Het
Prss3b C T 6: 41,010,079 (GRCm39) G85D probably benign Het
Ptprf C A 4: 118,093,236 (GRCm39) A469S probably benign Het
Ranbp3l T A 15: 9,057,304 (GRCm39) N322K probably damaging Het
Rev3l T A 10: 39,698,967 (GRCm39) Y1155N possibly damaging Het
Rfesd T C 13: 76,151,131 (GRCm39) Y96C probably damaging Het
Runx1 C T 16: 92,410,568 (GRCm39) V283I possibly damaging Het
Sema5b A C 16: 35,466,092 (GRCm39) Q125P probably damaging Het
Skic3 A G 13: 76,275,158 (GRCm39) D403G probably benign Het
Spef2 A T 15: 9,725,307 (GRCm39) M150K probably damaging Het
Srcap T G 7: 127,141,455 (GRCm39) L1745W probably damaging Het
Srgap2 A G 1: 131,283,365 (GRCm39) Y239H probably damaging Het
Svil T A 18: 5,090,811 (GRCm39) H1304Q possibly damaging Het
Syne1 T C 10: 5,179,193 (GRCm39) D4427G possibly damaging Het
Tg T A 15: 66,561,173 (GRCm39) M1065K probably benign Het
Tgm2 T C 2: 157,959,816 (GRCm39) T656A probably benign Het
Ubr4 A G 4: 139,153,235 (GRCm39) K809E Het
Vmn1r88 T C 7: 12,912,546 (GRCm39) S301P probably damaging Het
Wdr27 A G 17: 15,111,980 (GRCm39) V671A possibly damaging Het
Zbtb17 G A 4: 141,193,131 (GRCm39) V550I possibly damaging Het
Zeb2 A T 2: 44,887,920 (GRCm39) I379N probably damaging Het
Other mutations in Or5k14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02084:Or5k14 APN 16 58,693,399 (GRCm39) missense probably damaging 1.00
IGL02223:Or5k14 APN 16 58,693,057 (GRCm39) missense probably damaging 1.00
R0131:Or5k14 UTSW 16 58,693,269 (GRCm39) missense probably benign 0.01
R0131:Or5k14 UTSW 16 58,693,269 (GRCm39) missense probably benign 0.01
R0132:Or5k14 UTSW 16 58,693,269 (GRCm39) missense probably benign 0.01
R0245:Or5k14 UTSW 16 58,693,229 (GRCm39) missense probably benign 0.01
R0717:Or5k14 UTSW 16 58,693,133 (GRCm39) missense probably damaging 1.00
R0975:Or5k14 UTSW 16 58,693,513 (GRCm39) splice site probably null
R1037:Or5k14 UTSW 16 58,693,333 (GRCm39) missense probably damaging 1.00
R1256:Or5k14 UTSW 16 58,693,206 (GRCm39) nonsense probably null
R1278:Or5k14 UTSW 16 58,693,340 (GRCm39) missense probably damaging 1.00
R1538:Or5k14 UTSW 16 58,693,261 (GRCm39) missense probably damaging 1.00
R1992:Or5k14 UTSW 16 58,692,874 (GRCm39) missense probably benign 0.43
R2173:Or5k14 UTSW 16 58,692,982 (GRCm39) missense probably damaging 0.99
R2392:Or5k14 UTSW 16 58,692,797 (GRCm39) missense probably damaging 1.00
R5651:Or5k14 UTSW 16 58,692,847 (GRCm39) missense probably damaging 0.99
R5652:Or5k14 UTSW 16 58,692,847 (GRCm39) missense probably damaging 0.99
R5653:Or5k14 UTSW 16 58,692,847 (GRCm39) missense probably damaging 0.99
R8031:Or5k14 UTSW 16 58,693,054 (GRCm39) missense probably benign 0.03
R8108:Or5k14 UTSW 16 58,692,599 (GRCm39) missense probably benign
R8531:Or5k14 UTSW 16 58,693,016 (GRCm39) missense probably damaging 1.00
R8833:Or5k14 UTSW 16 58,692,959 (GRCm39) missense probably damaging 0.99
R9150:Or5k14 UTSW 16 58,693,005 (GRCm39) nonsense probably null
R9318:Or5k14 UTSW 16 58,692,748 (GRCm39) missense probably damaging 1.00
V8831:Or5k14 UTSW 16 58,693,438 (GRCm39) missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGCACAAGTAGATAAGGCTTTGC -3'
(R):5'- ACTACAGACTGCTTTCTTCTGG -3'

Sequencing Primer
(F):5'- CAAGTAGATAAGGCTTTGCTTCTTCC -3'
(R):5'- CATGGCCTATGACCGCTATGTG -3'
Posted On 2022-04-18