Mutagenetix > Incidental Mutation

Incidental Mutation 'R9389:Olfr177'

710510

Institutional Source

Beutler Lab

Gene Symbol

Olfr177

Ensembl Gene

ENSMUSG00000063137

Gene Name

olfactory receptor 177

Synonyms

GA_x54KRFPKG5P-55091371-55090442, MOR184-7

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.147) question?

Stock #

R9389 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58870955-58874768 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 58872613 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 179 (C179Y)

Ref Sequence

ENSEMBL: ENSMUSP00000150269 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072853] [ENSMUST00000217377]

AlphaFold

E9Q7W1

Predicted Effect

probably damaging
Transcript: ENSMUST00000072853
AA Change: C179Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000072631
Gene: ENSMUSG00000063137
AA Change: C179Y

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	2.7e-53	PFAM
Pfam:7TM_GPCR_Srsx	35	254	8.3e-6	PFAM
Pfam:7tm_1	41	290	1.2e-17	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000217377
AA Change: C179Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	C	T	6: 41,033,145	G85D	probably benign	Het
4931440F15Rik	A	G	11: 29,825,107	S117P	probably damaging	Het
Abcb1b	G	A	5: 8,825,614	V596I	probably benign	Het
Agtpbp1	A	T	13: 59,466,070	M1019K	probably damaging	Het
Arfgef3	A	G	10: 18,603,523	V1448A	probably damaging	Het
Baz1a	T	A	12: 54,916,823	E828D	probably damaging	Het
Ces1f	A	T	8: 93,269,972		probably null	Het
Cfap53	T	A	18: 74,299,343		probably null	Het
Col6a4	T	C	9: 106,000,784	Y1998C	probably damaging	Het
Col9a2	A	G	4: 121,054,751	T675A	probably benign	Het
Dusp6	G	A	10: 99,263,977	V96M	possibly damaging	Het
Elmo1	T	G	13: 20,185,491	M22R	probably benign	Het
Gm19965	A	G	1: 116,821,836	N416D		Het
Gpr162	A	G	6: 124,861,394	Y98H	probably damaging	Het
Igfals	G	A	17: 24,881,626	V564I	probably benign	Het
Il4	C	T	11: 53,614,010	R76H	probably damaging	Het
Itgb1	T	A	8: 128,707,156	N50K	probably benign	Het
Itpr3	A	T	17: 27,095,925	Y682F	possibly damaging	Het
Jak3	C	T	8: 71,684,052	P668S	probably damaging	Het
Malrd1	A	T	2: 15,703,156	N932I	unknown	Het
Mast4	C	A	13: 103,333,930	R88L	probably benign	Het
Mfsd11	T	G	11: 116,873,335	S381A	probably benign	Het
Mrm3	A	G	11: 76,250,030	D288G	probably damaging	Het
Myg1	G	T	15: 102,336,937	V198F	probably damaging	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Npy6r	T	C	18: 44,275,692	I60T	probably damaging	Het
Olfr1109	A	T	2: 87,093,046	M117K	possibly damaging	Het
Olfr1308	G	T	2: 111,960,527	P182H	probably damaging	Het
Olfr1341	A	T	4: 118,710,156	M250L	probably benign	Het
Olfr530	T	C	7: 140,373,017	T198A	probably benign	Het
Olfr811	G	A	10: 129,801,671	P285S	probably damaging	Het
Ovgp1	CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA	CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA	3: 105,986,525		probably benign	Het
Oxtr	C	A	6: 112,489,349	R150L	probably damaging	Het
Pappa	A	T	4: 65,180,888	Y548F	probably damaging	Het
Pip4k2a	T	C	2: 18,908,079	K73R	probably damaging	Het
Pla2g4f	T	A	2: 120,302,300	D685V	probably damaging	Het
Ppp1r35	T	A	5: 137,779,315	L81Q	probably damaging	Het
Ptprf	C	A	4: 118,236,039	A469S	probably benign	Het
Ranbp3l	T	A	15: 9,057,223	N322K	probably damaging	Het
Rev3l	T	A	10: 39,822,971	Y1155N	possibly damaging	Het
Rfesd	T	C	13: 76,003,012	Y96C	probably damaging	Het
Runx1	C	T	16: 92,613,680	V283I	possibly damaging	Het
Sema5b	A	C	16: 35,645,722	Q125P	probably damaging	Het
Spef2	A	T	15: 9,725,221	M150K	probably damaging	Het
Srcap	T	G	7: 127,542,283	L1745W	probably damaging	Het
Srgap2	A	G	1: 131,355,627	Y239H	probably damaging	Het
Svil	T	A	18: 5,090,811	H1304Q	possibly damaging	Het
Syne1	T	C	10: 5,229,193	D4427G	possibly damaging	Het
Tg	T	A	15: 66,689,324	M1065K	probably benign	Het
Tgm2	T	C	2: 158,117,896	T656A	probably benign	Het
Ttc37	A	G	13: 76,127,039	D403G	probably benign	Het
Ubr4	A	G	4: 139,425,924	K809E		Het
Vmn1r88	T	C	7: 13,178,619	S301P	probably damaging	Het
Wdr27	A	G	17: 14,891,718	V671A	possibly damaging	Het
Zbtb17	G	A	4: 141,465,820	V550I	possibly damaging	Het
Zeb2	A	T	2: 44,997,908	I379N	probably damaging	Het

Other mutations in Olfr177

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02084:Olfr177	APN	16	58873036	missense	probably damaging	1.00
IGL02223:Olfr177	APN	16	58872694	missense	probably damaging	1.00
R0131:Olfr177	UTSW	16	58872906	missense	probably benign	0.01
R0131:Olfr177	UTSW	16	58872906	missense	probably benign	0.01
R0132:Olfr177	UTSW	16	58872906	missense	probably benign	0.01
R0245:Olfr177	UTSW	16	58872866	missense	probably benign	0.01
R0717:Olfr177	UTSW	16	58872770	missense	probably damaging	1.00
R0975:Olfr177	UTSW	16	58873150	splice site	probably null
R1037:Olfr177	UTSW	16	58872970	missense	probably damaging	1.00
R1256:Olfr177	UTSW	16	58872843	nonsense	probably null
R1278:Olfr177	UTSW	16	58872977	missense	probably damaging	1.00
R1538:Olfr177	UTSW	16	58872898	missense	probably damaging	1.00
R1992:Olfr177	UTSW	16	58872511	missense	probably benign	0.43
R2173:Olfr177	UTSW	16	58872619	missense	probably damaging	0.99
R2392:Olfr177	UTSW	16	58872434	missense	probably damaging	1.00
R5651:Olfr177	UTSW	16	58872484	missense	probably damaging	0.99
R5652:Olfr177	UTSW	16	58872484	missense	probably damaging	0.99
R5653:Olfr177	UTSW	16	58872484	missense	probably damaging	0.99
R8031:Olfr177	UTSW	16	58872691	missense	probably benign	0.03
R8108:Olfr177	UTSW	16	58872236	missense	probably benign
R8531:Olfr177	UTSW	16	58872653	missense	probably damaging	1.00
R8833:Olfr177	UTSW	16	58872596	missense	probably damaging	0.99
R9150:Olfr177	UTSW	16	58872642	nonsense	probably null
R9318:Olfr177	UTSW	16	58872385	missense	probably damaging	1.00
V8831:Olfr177	UTSW	16	58873075	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- TGCACAAGTAGATAAGGCTTTGC -3'
(R):5'- ACTACAGACTGCTTTCTTCTGG -3'

Sequencing Primer
(F):5'- CAAGTAGATAAGGCTTTGCTTCTTCC -3'
(R):5'- CATGGCCTATGACCGCTATGTG -3'

Posted On

2022-04-18