Incidental Mutation 'R9389:Wdr27'
ID 710512
Institutional Source Beutler Lab
Gene Symbol Wdr27
Ensembl Gene ENSMUSG00000046991
Gene Name WD repeat domain 27
Synonyms 0610012K18Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.170) question?
Stock # R9389 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 15038781-15163420 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 15111980 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 671 (V671A)
Ref Sequence ENSEMBL: ENSMUSP00000126736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170386] [ENSMUST00000228330] [ENSMUST00000232147]
AlphaFold Q8C5V5
Predicted Effect possibly damaging
Transcript: ENSMUST00000170386
AA Change: V671A

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126736
Gene: ENSMUSG00000046991
AA Change: V671A

DomainStartEndE-ValueType
WD40 59 99 4.79e-1 SMART
WD40 114 149 6.36e1 SMART
WD40 152 192 3.93e-7 SMART
WD40 195 235 2.38e1 SMART
low complexity region 473 492 N/A INTRINSIC
WD40 498 539 1.48e1 SMART
WD40 542 581 5.26e-8 SMART
WD40 642 684 2.97e0 SMART
WD40 687 737 7.64e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000228330
AA Change: V671A

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000232147
AA Change: V671A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple WD repeats. Proteins with these repeats may form scaffolds for protein-protein interaction and play key roles in cell signalling. Alternative splicing results in multiple transcript variants, but the full-length structure of some of these variants cannot be determined. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,875,614 (GRCm39) V596I probably benign Het
Agtpbp1 A T 13: 59,613,884 (GRCm39) M1019K probably damaging Het
Arfgef3 A G 10: 18,479,271 (GRCm39) V1448A probably damaging Het
Baz1a T A 12: 54,963,608 (GRCm39) E828D probably damaging Het
Ces1f A T 8: 93,996,600 (GRCm39) probably null Het
Cfap53 T A 18: 74,432,414 (GRCm39) probably null Het
Col6a4 T C 9: 105,877,983 (GRCm39) Y1998C probably damaging Het
Col9a2 A G 4: 120,911,948 (GRCm39) T675A probably benign Het
Dusp6 G A 10: 99,099,839 (GRCm39) V96M possibly damaging Het
Elmo1 T G 13: 20,369,661 (GRCm39) M22R probably benign Het
Fem1al A G 11: 29,775,107 (GRCm39) S117P probably damaging Het
Gm19965 A G 1: 116,749,566 (GRCm39) N416D Het
Gpr162 A G 6: 124,838,357 (GRCm39) Y98H probably damaging Het
Igfals G A 17: 25,100,600 (GRCm39) V564I probably benign Het
Il4 C T 11: 53,504,837 (GRCm39) R76H probably damaging Het
Itgb1 T A 8: 129,433,637 (GRCm39) N50K probably benign Het
Itpr3 A T 17: 27,314,899 (GRCm39) Y682F possibly damaging Het
Jak3 C T 8: 72,136,696 (GRCm39) P668S probably damaging Het
Malrd1 A T 2: 15,707,967 (GRCm39) N932I unknown Het
Mast4 C A 13: 103,470,438 (GRCm39) R88L probably benign Het
Mfsd11 T G 11: 116,764,161 (GRCm39) S381A probably benign Het
Mrm3 A G 11: 76,140,856 (GRCm39) D288G probably damaging Het
Myg1 G T 15: 102,245,372 (GRCm39) V198F probably damaging Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Npy6r T C 18: 44,408,759 (GRCm39) I60T probably damaging Het
Or12j3 T C 7: 139,952,930 (GRCm39) T198A probably benign Het
Or13p3 A T 4: 118,567,353 (GRCm39) M250L probably benign Het
Or4f57 G T 2: 111,790,872 (GRCm39) P182H probably damaging Het
Or5aq6 A T 2: 86,923,390 (GRCm39) M117K possibly damaging Het
Or5k14 C T 16: 58,692,976 (GRCm39) C179Y probably damaging Het
Or6c215 G A 10: 129,637,540 (GRCm39) P285S probably damaging Het
Ovgp1 CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA 3: 105,893,841 (GRCm39) probably benign Het
Oxtr C A 6: 112,466,310 (GRCm39) R150L probably damaging Het
Pappa A T 4: 65,099,125 (GRCm39) Y548F probably damaging Het
Pip4k2a T C 2: 18,912,890 (GRCm39) K73R probably damaging Het
Pla2g4f T A 2: 120,132,781 (GRCm39) D685V probably damaging Het
Ppp1r35 T A 5: 137,777,577 (GRCm39) L81Q probably damaging Het
Prss3b C T 6: 41,010,079 (GRCm39) G85D probably benign Het
Ptprf C A 4: 118,093,236 (GRCm39) A469S probably benign Het
Ranbp3l T A 15: 9,057,304 (GRCm39) N322K probably damaging Het
Rev3l T A 10: 39,698,967 (GRCm39) Y1155N possibly damaging Het
Rfesd T C 13: 76,151,131 (GRCm39) Y96C probably damaging Het
Runx1 C T 16: 92,410,568 (GRCm39) V283I possibly damaging Het
Sema5b A C 16: 35,466,092 (GRCm39) Q125P probably damaging Het
Skic3 A G 13: 76,275,158 (GRCm39) D403G probably benign Het
Spef2 A T 15: 9,725,307 (GRCm39) M150K probably damaging Het
Srcap T G 7: 127,141,455 (GRCm39) L1745W probably damaging Het
Srgap2 A G 1: 131,283,365 (GRCm39) Y239H probably damaging Het
Svil T A 18: 5,090,811 (GRCm39) H1304Q possibly damaging Het
Syne1 T C 10: 5,179,193 (GRCm39) D4427G possibly damaging Het
Tg T A 15: 66,561,173 (GRCm39) M1065K probably benign Het
Tgm2 T C 2: 157,959,816 (GRCm39) T656A probably benign Het
Ubr4 A G 4: 139,153,235 (GRCm39) K809E Het
Vmn1r88 T C 7: 12,912,546 (GRCm39) S301P probably damaging Het
Zbtb17 G A 4: 141,193,131 (GRCm39) V550I possibly damaging Het
Zeb2 A T 2: 44,887,920 (GRCm39) I379N probably damaging Het
Other mutations in Wdr27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Wdr27 APN 17 15,148,572 (GRCm39) nonsense probably null
IGL00973:Wdr27 APN 17 15,134,140 (GRCm39) missense probably benign 0.01
IGL01012:Wdr27 APN 17 15,146,509 (GRCm39) missense probably damaging 1.00
IGL01924:Wdr27 APN 17 15,137,488 (GRCm39) missense probably damaging 0.99
IGL02044:Wdr27 APN 17 15,122,031 (GRCm39) missense possibly damaging 0.72
IGL02198:Wdr27 APN 17 15,128,860 (GRCm39) missense possibly damaging 0.52
IGL02430:Wdr27 APN 17 15,122,062 (GRCm39) missense probably damaging 0.98
IGL02496:Wdr27 APN 17 15,112,693 (GRCm39) splice site probably benign
IGL02552:Wdr27 APN 17 15,146,453 (GRCm39) missense probably damaging 1.00
IGL02590:Wdr27 APN 17 15,138,041 (GRCm39) missense possibly damaging 0.93
IGL02892:Wdr27 APN 17 15,096,438 (GRCm39) missense possibly damaging 0.95
IGL02957:Wdr27 APN 17 15,130,372 (GRCm39) splice site probably benign
IGL03295:Wdr27 APN 17 15,154,837 (GRCm39) missense possibly damaging 0.71
PIT4498001:Wdr27 UTSW 17 15,154,831 (GRCm39) missense probably benign 0.01
R0329:Wdr27 UTSW 17 15,154,721 (GRCm39) splice site probably benign
R0671:Wdr27 UTSW 17 15,148,658 (GRCm39) missense probably benign 0.04
R1166:Wdr27 UTSW 17 15,112,733 (GRCm39) missense probably damaging 1.00
R1308:Wdr27 UTSW 17 15,148,646 (GRCm39) missense probably damaging 0.98
R1652:Wdr27 UTSW 17 15,137,532 (GRCm39) missense probably benign 0.01
R1771:Wdr27 UTSW 17 15,112,703 (GRCm39) missense probably damaging 1.00
R1966:Wdr27 UTSW 17 15,154,861 (GRCm39) missense possibly damaging 0.86
R2106:Wdr27 UTSW 17 15,141,116 (GRCm39) missense probably benign 0.44
R2131:Wdr27 UTSW 17 15,148,594 (GRCm39) missense probably damaging 1.00
R3803:Wdr27 UTSW 17 15,138,371 (GRCm39) missense probably benign 0.01
R4335:Wdr27 UTSW 17 15,141,018 (GRCm39) splice site probably null
R4577:Wdr27 UTSW 17 15,123,724 (GRCm39) missense probably benign 0.00
R4787:Wdr27 UTSW 17 15,152,816 (GRCm39) missense possibly damaging 0.86
R4853:Wdr27 UTSW 17 15,137,475 (GRCm39) splice site probably null
R4922:Wdr27 UTSW 17 15,141,016 (GRCm39) splice site probably null
R4951:Wdr27 UTSW 17 15,096,395 (GRCm39) missense probably damaging 0.99
R5784:Wdr27 UTSW 17 15,146,495 (GRCm39) missense probably damaging 1.00
R5809:Wdr27 UTSW 17 15,103,931 (GRCm39) missense probably damaging 1.00
R6128:Wdr27 UTSW 17 15,152,796 (GRCm39) nonsense probably null
R6584:Wdr27 UTSW 17 15,122,031 (GRCm39) missense probably damaging 1.00
R6705:Wdr27 UTSW 17 15,154,852 (GRCm39) missense probably damaging 1.00
R7511:Wdr27 UTSW 17 15,103,965 (GRCm39) missense probably benign 0.00
R8273:Wdr27 UTSW 17 15,049,838 (GRCm39) missense probably benign
R8350:Wdr27 UTSW 17 15,152,787 (GRCm39) missense probably benign
R8353:Wdr27 UTSW 17 15,112,751 (GRCm39) missense probably benign 0.08
R8450:Wdr27 UTSW 17 15,152,787 (GRCm39) missense probably benign
R8453:Wdr27 UTSW 17 15,112,751 (GRCm39) missense probably benign 0.08
R8535:Wdr27 UTSW 17 15,123,799 (GRCm39) missense possibly damaging 0.88
R8735:Wdr27 UTSW 17 15,103,929 (GRCm39) missense probably damaging 1.00
R8960:Wdr27 UTSW 17 15,103,908 (GRCm39) missense probably benign 0.01
R9120:Wdr27 UTSW 17 15,152,846 (GRCm39) missense probably damaging 1.00
R9183:Wdr27 UTSW 17 15,148,651 (GRCm39) missense possibly damaging 0.50
R9351:Wdr27 UTSW 17 15,128,833 (GRCm39) missense possibly damaging 0.52
R9373:Wdr27 UTSW 17 15,154,795 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACCTGGCAATAGTTACAAAATTGC -3'
(R):5'- GTCTTGTACCATGTGCTCGC -3'

Sequencing Primer
(F):5'- CAAATTCGATGAACAGGCC -3'
(R):5'- ACTCCCCGTGAGCTCTG -3'
Posted On 2022-04-18