Mutagenetix > Incidental Mutation

Incidental Mutation 'R9390:Fga'

710528

Institutional Source

Beutler Lab

Gene Symbol

Fga

Ensembl Gene

ENSMUSG00000028001

Gene Name

fibrinogen alpha chain

Synonyms

ENSMUSG00000059807, Fib

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.322) question?

Stock #

R9390 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

83026076-83033627 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 83033303 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 755 (N755Y)

Ref Sequence

ENSEMBL: ENSMUSP00000133117 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]

AlphaFold

E9PV24

Predicted Effect

probably benign
Transcript: ENSMUST00000029630

SMART Domains

Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	31	43	N/A	INTRINSIC
Fib_alpha	49	193	1.29e-69	SMART
low complexity region	264	286	N/A	INTRINSIC
low complexity region	311	340	N/A	INTRINSIC
Pfam:Fibrinogen_aC	392	458	1.6e-33	PFAM
low complexity region	500	522	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166581
AA Change: N755Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: N755Y

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	31	43	N/A	INTRINSIC
Fib_alpha	49	193	1.29e-69	SMART
low complexity region	264	286	N/A	INTRINSIC
low complexity region	311	340	N/A	INTRINSIC
Pfam:Fibrinogen_aC	392	457	9.3e-34	PFAM
low complexity region	500	522	N/A	INTRINSIC
FBG	550	786	1.43e-128	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438H23Rik	A	T	16: 91,056,208	S13R	probably benign	Het
Amn1	A	T	6: 149,183,485	D32E	probably damaging	Het
Asph	T	C	4: 9,635,927	D108G	probably damaging	Het
BC027072	T	C	17: 71,750,988	T565A	probably benign	Het
C1rb	T	C	6: 124,580,377	L491P	probably damaging	Het
Cep120	G	A	18: 53,706,912	R759*	probably null	Het
Chmp6	C	T	11: 119,915,462	T38M	possibly damaging	Het
Comtd1	A	G	14: 21,848,799	F25S	possibly damaging	Het
Dthd1	G	A	5: 62,818,561	G193R	possibly damaging	Het
Dyrk1a	T	A	16: 94,673,471	S362R	probably damaging	Het
Ecm2	A	G	13: 49,530,316	D590G	probably benign	Het
Exd1	A	T	2: 119,523,699	W293R	probably damaging	Het
Fam110a	C	T	2: 151,970,196	R218Q	probably benign	Het
Fstl4	C	A	11: 53,000,275	T80K	probably benign	Het
Gbp5	A	G	3: 142,503,022	K109E	probably benign	Het
Gucy2g	A	G	19: 55,202,175	V1009A	probably null	Het
Herc6	C	T	6: 57,625,970	Q545*	probably null	Het
Hpd	T	A	5: 123,180,731		probably null	Het
Il4	C	T	11: 53,614,010	R76H	probably damaging	Het
Inpp4b	T	C	8: 81,770,893	V114A	probably damaging	Het
Ints14	A	G	9: 64,984,032	T432A	probably benign	Het
Isoc1	G	A	18: 58,671,278	R126H	probably damaging	Het
Klb	G	T	5: 65,375,701	R451L	possibly damaging	Het
Lrtm2	C	T	6: 119,320,987	C31Y	probably benign	Het
Mga	C	T	2: 119,963,851	S2672F	probably damaging	Het
Mkrn3	T	C	7: 62,419,540	I168V	probably benign	Het
Mlph	C	T	1: 90,939,366	T370I	probably benign	Het
Naaladl1	A	T	19: 6,112,695	I478F	probably damaging	Het
Neb	A	T	2: 52,175,145	H6251Q	probably benign	Het
Nom1	C	T	5: 29,434,768	R31C	probably benign	Het
Nup153	A	C	13: 46,687,166	F989V	probably damaging	Het
Nup188	T	C	2: 30,330,765		probably null	Het
Olfr1109	A	T	2: 87,093,046	M117K	possibly damaging	Het
Olfr1259	T	C	2: 89,943,225	K297E	probably benign	Het
Olfr800	A	G	10: 129,660,069	T88A	probably benign	Het
Ovgp1	T	C	3: 105,986,567		probably benign	Het
Pcdhb4	T	C	18: 37,309,728	V697A	possibly damaging	Het
Pds5a	G	T	5: 65,666,257	Q64K	probably benign	Het
Pmpcb	T	C	5: 21,748,812	F353L	probably damaging	Het
Pus10	G	A	11: 23,706,937	C221Y	probably damaging	Het
Qrfp	A	G	2: 31,808,737	V61A	possibly damaging	Het
Runx1t1	A	G	4: 13,865,932	I393M	probably benign	Het
Sh2d5	T	G	4: 138,258,170	S310A	probably benign	Het
Shisa9	A	G	16: 12,267,544	E339G	possibly damaging	Het
Slc26a10	C	T	10: 127,173,370	E641K	probably benign	Het
Slc5a6	A	G	5: 31,040,459	V302A	possibly damaging	Het
Tdrd7	T	A	4: 46,005,416	D407E	probably damaging	Het
Trp53	A	T	11: 69,587,568	Q101L	probably benign	Het
Tsc2	T	A	17: 24,604,850	N994Y	probably damaging	Het
Ttc16	T	G	2: 32,767,183	K577Q	possibly damaging	Het
Vmn1r195	A	G	13: 22,278,365	I2V	probably benign	Het
Vmn2r83	G	T	10: 79,481,488	E522*	probably null	Het
Wdr48	T	A	9: 119,917,179	F450L	probably benign	Het
Wnt9a	G	A	11: 59,327,766	E100K	possibly damaging	Het
Zfp729b	A	T	13: 67,591,063	S1028T	probably benign	Het
Zfp729b	C	T	13: 67,593,895	V84I	possibly damaging	Het

Other mutations in Fga

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Fga	APN	3	83031674	missense	probably damaging	1.00
IGL00478:Fga	APN	3	83028644	missense	probably benign	0.00
IGL00587:Fga	APN	3	83030289	missense	possibly damaging	0.62
IGL01289:Fga	APN	3	83031245	missense	possibly damaging	0.85
IGL01323:Fga	APN	3	83030211	missense	probably damaging	0.99
IGL01369:Fga	APN	3	83030200	missense	probably benign	0.00
IGL01409:Fga	APN	3	83032752	missense	probably damaging	1.00
IGL01541:Fga	APN	3	83032707	missense	probably damaging	1.00
IGL01633:Fga	APN	3	83030299	missense	possibly damaging	0.89
IGL01966:Fga	APN	3	83029154	missense	probably damaging	0.97
IGL02651:Fga	APN	3	83028534	missense	probably benign	0.00
IGL02822:Fga	APN	3	83031482	missense	probably damaging	1.00
IGL03003:Fga	APN	3	83032730	missense	probably damaging	1.00
R0336:Fga	UTSW	3	83030857	missense	probably damaging	1.00
R0540:Fga	UTSW	3	83028562	missense	probably damaging	1.00
R0607:Fga	UTSW	3	83028562	missense	probably damaging	1.00
R1471:Fga	UTSW	3	83028618	missense	probably benign	0.16
R1517:Fga	UTSW	3	83031838	missense	probably benign	0.00
R1817:Fga	UTSW	3	83031775	missense	probably benign	0.00
R1874:Fga	UTSW	3	83032721	missense	probably damaging	1.00
R2014:Fga	UTSW	3	83032757	missense	probably damaging	0.99
R2267:Fga	UTSW	3	83032950	missense	probably damaging	1.00
R2332:Fga	UTSW	3	83031397	missense	probably damaging	1.00
R2420:Fga	UTSW	3	83033154	missense	possibly damaging	0.53
R2443:Fga	UTSW	3	83028541	missense	probably benign	0.03
R3978:Fga	UTSW	3	83030183	critical splice acceptor site	probably null
R4597:Fga	UTSW	3	83031235	nonsense	probably null
R4644:Fga	UTSW	3	83030266	missense	possibly damaging	0.81
R4760:Fga	UTSW	3	83031514	missense	probably benign
R4867:Fga	UTSW	3	83028644	missense	probably benign	0.00
R5449:Fga	UTSW	3	83030862	frame shift	probably null
R5507:Fga	UTSW	3	83033336	missense	probably damaging	1.00
R5712:Fga	UTSW	3	83033133	missense	possibly damaging	0.70
R6853:Fga	UTSW	3	83030912	missense	probably damaging	1.00
R6865:Fga	UTSW	3	83031541	missense	probably damaging	1.00
R7163:Fga	UTSW	3	83026264	missense	probably benign	0.04
R7724:Fga	UTSW	3	83029125	missense	probably damaging	0.99
R8153:Fga	UTSW	3	83030857	missense	probably damaging	1.00
R8506:Fga	UTSW	3	83033316	missense	probably damaging	1.00
R8511:Fga	UTSW	3	83031757	nonsense	probably null
R8523:Fga	UTSW	3	83030851	missense	probably damaging	1.00
R8801:Fga	UTSW	3	83030881	missense	possibly damaging	0.89
R8906:Fga	UTSW	3	83031804	missense	probably benign	0.12
R9609:Fga	UTSW	3	83032757	missense	probably damaging	1.00
X0062:Fga	UTSW	3	83030271	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- GGGGACAGAATACACCTCAC -3'
(R):5'- CAAAGAACAATGGAATAGCACCTTG -3'

Sequencing Primer
(F):5'- GGACAGAATACACCTCACACAGC -3'
(R):5'- GTTCACAAGATCCGTGACACCTTC -3'

Posted On

2022-04-18