Incidental Mutation 'R9390:Asph'
ID 710531
Institutional Source Beutler Lab
Gene Symbol Asph
Ensembl Gene ENSMUSG00000028207
Gene Name aspartate-beta-hydroxylase
Synonyms calsequestrin-binding protein, 2310005F16Rik, aspartyl beta-hydroxylase, jumbug, BAH, Junctin, junctate, 3110001L23Rik, cI-37
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9390 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 9449085-9669344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 9635927 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 108 (D108G)
Ref Sequence ENSEMBL: ENSMUSP00000077273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038564] [ENSMUST00000078139] [ENSMUST00000084912] [ENSMUST00000084915] [ENSMUST00000098275] [ENSMUST00000103004] [ENSMUST00000108333] [ENSMUST00000108334] [ENSMUST00000108335] [ENSMUST00000108337] [ENSMUST00000108339] [ENSMUST00000108340] [ENSMUST00000131605] [ENSMUST00000146441] [ENSMUST00000152526]
AlphaFold Q8BSY0
Predicted Effect probably damaging
Transcript: ENSMUST00000038564
AA Change: D108G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049018
Gene: ENSMUSG00000028207
AA Change: D108G

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 244 1.6e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078139
AA Change: D108G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077273
Gene: ENSMUSG00000028207
AA Change: D108G

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 307 7e-104 PFAM
Pfam:TPR_6 326 357 4.4e-5 PFAM
Pfam:TPR_16 328 398 1.3e-9 PFAM
Pfam:TPR_2 439 470 2.6e-4 PFAM
Pfam:TPR_8 441 470 1.7e-3 PFAM
Pfam:Asp_Arg_Hydrox 574 728 7.6e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084912
AA Change: D123G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081975
Gene: ENSMUSG00000028207
AA Change: D123G

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 163 1.5e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084915
AA Change: D108G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081978
Gene: ENSMUSG00000028207
AA Change: D108G

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 307 6.2e-105 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098275
AA Change: D108G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095876
Gene: ENSMUSG00000028207
AA Change: D108G

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 188 5.6e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103004
AA Change: D70G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100069
Gene: ENSMUSG00000028207
AA Change: D70G

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 14 81 5.2e-49 PFAM
Pfam:Asp-B-Hydro_N 78 206 1.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108333
AA Change: D70G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103970
Gene: ENSMUSG00000028207
AA Change: D70G

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 14 128 5.8e-59 PFAM
Pfam:Asp-B-Hydro_N 121 258 8.8e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108334
AA Change: D70G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103971
Gene: ENSMUSG00000028207
AA Change: D70G

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 14 269 3.8e-105 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108335
AA Change: D70G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103972
Gene: ENSMUSG00000028207
AA Change: D70G

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 14 84 1.6e-49 PFAM
Pfam:Asp-B-Hydro_N 79 212 1.6e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108337
AA Change: D108G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103974
Gene: ENSMUSG00000028207
AA Change: D108G

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 291 1.8e-96 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108339
AA Change: D41G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103976
Gene: ENSMUSG00000028207
AA Change: D41G

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 1 224 1.6e-80 PFAM
Pfam:TPR_6 243 274 1.4e-4 PFAM
Pfam:TPR_16 245 315 2.5e-9 PFAM
Pfam:TPR_2 356 387 7e-4 PFAM
Pfam:Asp_Arg_Hydrox 489 646 5.3e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108340
AA Change: D108G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103977
Gene: ENSMUSG00000028207
AA Change: D108G

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 291 8.6e-96 PFAM
Pfam:TPR_6 310 341 1.9e-4 PFAM
Pfam:TPR_16 312 382 2.9e-9 PFAM
Pfam:TPR_2 423 454 6.8e-4 PFAM
Pfam:Asp_Arg_Hydrox 556 713 3.8e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131605
AA Change: D56G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118518
Gene: ENSMUSG00000028207
AA Change: D56G

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 1 73 2.7e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146441
AA Change: D123G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116899
Gene: ENSMUSG00000028207
AA Change: D123G

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 203 1.2e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000152526
AA Change: D70G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116874
Gene: ENSMUSG00000028207
AA Change: D70G

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 14 149 8.2e-70 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play an important role in calcium homeostasis. The gene is expressed from two promoters and undergoes extensive alternative splicing. The encoded set of proteins share varying amounts of overlap near their N-termini but have substantial variations in their C-terminal domains resulting in distinct functional properties. The longest isoforms (a and f) include a C-terminal Aspartyl/Asparaginyl beta-hydroxylase domain that hydroxylates aspartic acid or asparagine residues in the epidermal growth factor (EGF)-like domains of some proteins, including protein C, coagulation factors VII, IX, and X, and the complement factors C1R and C1S. Other isoforms differ primarily in the C-terminal sequence and lack the hydroxylase domain, and some have been localized to the endoplasmic and sarcoplasmic reticulum. Some of these isoforms are found in complexes with calsequestrin, triadin, and the ryanodine receptor, and have been shown to regulate calcium release from the sarcoplasmic reticulum. Some isoforms have been implicated in metastasis. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for a mutation lacking aspartyl beta-hydroxylase expression exhibit syndactyly, facial dysmorphology, mild hard palate defects, and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik A T 16: 90,853,096 (GRCm39) S13R probably benign Het
Amn1 A T 6: 149,084,983 (GRCm39) D32E probably damaging Het
C1rb T C 6: 124,557,336 (GRCm39) L491P probably damaging Het
Cep120 G A 18: 53,839,984 (GRCm39) R759* probably null Het
Chmp6 C T 11: 119,806,288 (GRCm39) T38M possibly damaging Het
Comtd1 A G 14: 21,898,867 (GRCm39) F25S possibly damaging Het
Dthd1 G A 5: 62,975,904 (GRCm39) G193R possibly damaging Het
Dyrk1a T A 16: 94,474,330 (GRCm39) S362R probably damaging Het
Ecm2 A G 13: 49,683,792 (GRCm39) D590G probably benign Het
Exd1 A T 2: 119,354,180 (GRCm39) W293R probably damaging Het
Fam110a C T 2: 151,812,116 (GRCm39) R218Q probably benign Het
Fga A T 3: 82,940,610 (GRCm39) N755Y probably damaging Het
Fstl4 C A 11: 52,891,102 (GRCm39) T80K probably benign Het
Gbp5 A G 3: 142,208,783 (GRCm39) K109E probably benign Het
Gucy2g A G 19: 55,190,607 (GRCm39) V1009A probably null Het
Herc6 C T 6: 57,602,955 (GRCm39) Q545* probably null Het
Hpd T A 5: 123,318,794 (GRCm39) probably null Het
Il4 C T 11: 53,504,837 (GRCm39) R76H probably damaging Het
Inpp4b T C 8: 82,497,522 (GRCm39) V114A probably damaging Het
Ints14 A G 9: 64,891,314 (GRCm39) T432A probably benign Het
Isoc1 G A 18: 58,804,350 (GRCm39) R126H probably damaging Het
Klb G T 5: 65,533,044 (GRCm39) R451L possibly damaging Het
Lrtm2 C T 6: 119,297,948 (GRCm39) C31Y probably benign Het
Mga C T 2: 119,794,332 (GRCm39) S2672F probably damaging Het
Mkrn3 T C 7: 62,069,288 (GRCm39) I168V probably benign Het
Mlph C T 1: 90,867,088 (GRCm39) T370I probably benign Het
Naaladl1 A T 19: 6,162,725 (GRCm39) I478F probably damaging Het
Neb A T 2: 52,065,157 (GRCm39) H6251Q probably benign Het
Nom1 C T 5: 29,639,766 (GRCm39) R31C probably benign Het
Nup153 A C 13: 46,840,642 (GRCm39) F989V probably damaging Het
Nup188 T C 2: 30,220,777 (GRCm39) probably null Het
Or4c12 T C 2: 89,773,569 (GRCm39) K297E probably benign Het
Or5aq6 A T 2: 86,923,390 (GRCm39) M117K possibly damaging Het
Or6c210 A G 10: 129,495,938 (GRCm39) T88A probably benign Het
Ovgp1 T C 3: 105,893,883 (GRCm39) probably benign Het
Pcare T C 17: 72,057,983 (GRCm39) T565A probably benign Het
Pcdhb4 T C 18: 37,442,781 (GRCm39) V697A possibly damaging Het
Pds5a G T 5: 65,823,600 (GRCm39) Q64K probably benign Het
Pmpcb T C 5: 21,953,810 (GRCm39) F353L probably damaging Het
Pus10 G A 11: 23,656,937 (GRCm39) C221Y probably damaging Het
Qrfp A G 2: 31,698,749 (GRCm39) V61A possibly damaging Het
Runx1t1 A G 4: 13,865,932 (GRCm39) I393M probably benign Het
Sh2d5 T G 4: 137,985,481 (GRCm39) S310A probably benign Het
Shisa9 A G 16: 12,085,408 (GRCm39) E339G possibly damaging Het
Slc26a10 C T 10: 127,009,239 (GRCm39) E641K probably benign Het
Slc5a6 A G 5: 31,197,803 (GRCm39) V302A possibly damaging Het
Tdrd7 T A 4: 46,005,416 (GRCm39) D407E probably damaging Het
Trp53 A T 11: 69,478,394 (GRCm39) Q101L probably benign Het
Tsc2 T A 17: 24,823,824 (GRCm39) N994Y probably damaging Het
Ttc16 T G 2: 32,657,195 (GRCm39) K577Q possibly damaging Het
Vmn1r195 A G 13: 22,462,535 (GRCm39) I2V probably benign Het
Vmn2r83 G T 10: 79,317,322 (GRCm39) E522* probably null Het
Wdr48 T A 9: 119,746,245 (GRCm39) F450L probably benign Het
Wnt9a G A 11: 59,218,592 (GRCm39) E100K possibly damaging Het
Zfp729b A T 13: 67,739,182 (GRCm39) S1028T probably benign Het
Zfp729b C T 13: 67,742,014 (GRCm39) V84I possibly damaging Het
Other mutations in Asph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Asph APN 4 9,639,322 (GRCm39) missense probably damaging 1.00
IGL00928:Asph APN 4 9,594,675 (GRCm39) missense probably benign 0.07
IGL01022:Asph APN 4 9,601,344 (GRCm39) missense possibly damaging 0.63
IGL01677:Asph APN 4 9,607,853 (GRCm39) missense probably damaging 1.00
IGL01907:Asph APN 4 9,514,643 (GRCm39) missense possibly damaging 0.59
IGL01958:Asph APN 4 9,474,904 (GRCm39) missense possibly damaging 0.93
IGL01976:Asph APN 4 9,475,471 (GRCm39) missense probably damaging 0.98
IGL01989:Asph APN 4 9,602,462 (GRCm39) splice site probably benign
IGL02379:Asph APN 4 9,474,980 (GRCm39) missense probably damaging 1.00
IGL02444:Asph APN 4 9,542,319 (GRCm39) splice site probably benign
IGL02652:Asph APN 4 9,529,984 (GRCm39) missense probably benign 0.11
IGL02679:Asph APN 4 9,601,349 (GRCm39) missense possibly damaging 0.63
IGL02735:Asph APN 4 9,598,759 (GRCm39) missense probably damaging 1.00
IGL02875:Asph APN 4 9,595,380 (GRCm39) missense probably damaging 1.00
IGL03022:Asph APN 4 9,517,668 (GRCm39) missense possibly damaging 0.48
R0026:Asph UTSW 4 9,601,361 (GRCm39) missense probably damaging 0.97
R0121:Asph UTSW 4 9,635,918 (GRCm39) missense probably damaging 1.00
R0357:Asph UTSW 4 9,453,314 (GRCm39) missense probably benign 0.01
R0410:Asph UTSW 4 9,595,415 (GRCm39) missense probably damaging 1.00
R0554:Asph UTSW 4 9,604,581 (GRCm39) missense probably damaging 0.99
R0577:Asph UTSW 4 9,604,620 (GRCm39) missense probably benign 0.02
R0718:Asph UTSW 4 9,514,683 (GRCm39) splice site probably benign
R0725:Asph UTSW 4 9,542,275 (GRCm39) missense probably damaging 1.00
R1383:Asph UTSW 4 9,537,807 (GRCm39) splice site probably null
R1654:Asph UTSW 4 9,453,315 (GRCm39) missense probably benign 0.31
R1694:Asph UTSW 4 9,610,869 (GRCm39) missense probably damaging 0.99
R1771:Asph UTSW 4 9,598,773 (GRCm39) missense probably damaging 0.99
R1776:Asph UTSW 4 9,598,773 (GRCm39) missense probably damaging 0.99
R1840:Asph UTSW 4 9,601,340 (GRCm39) missense possibly damaging 0.60
R1911:Asph UTSW 4 9,453,335 (GRCm39) missense probably damaging 1.00
R1912:Asph UTSW 4 9,453,335 (GRCm39) missense probably damaging 1.00
R2117:Asph UTSW 4 9,517,671 (GRCm39) nonsense probably null
R2860:Asph UTSW 4 9,598,277 (GRCm39) missense probably damaging 1.00
R2861:Asph UTSW 4 9,598,277 (GRCm39) missense probably damaging 1.00
R2937:Asph UTSW 4 9,542,314 (GRCm39) splice site probably benign
R3907:Asph UTSW 4 9,474,934 (GRCm39) missense probably benign 0.23
R4154:Asph UTSW 4 9,639,250 (GRCm39) nonsense probably null
R4623:Asph UTSW 4 9,622,005 (GRCm39) missense possibly damaging 0.50
R4871:Asph UTSW 4 9,531,968 (GRCm39) missense probably benign 0.02
R5196:Asph UTSW 4 9,607,830 (GRCm39) missense probably damaging 0.99
R5540:Asph UTSW 4 9,635,906 (GRCm39) missense probably damaging 1.00
R5757:Asph UTSW 4 9,637,722 (GRCm39) splice site probably null
R6063:Asph UTSW 4 9,531,960 (GRCm39) missense probably benign 0.05
R6072:Asph UTSW 4 9,643,533 (GRCm39) critical splice donor site probably null
R7016:Asph UTSW 4 9,630,604 (GRCm39) splice site probably null
R7133:Asph UTSW 4 9,484,575 (GRCm39) missense probably benign 0.01
R7154:Asph UTSW 4 9,630,930 (GRCm39) missense possibly damaging 0.85
R7201:Asph UTSW 4 9,474,917 (GRCm39) missense probably damaging 1.00
R7316:Asph UTSW 4 9,537,746 (GRCm39) missense probably benign 0.11
R7455:Asph UTSW 4 9,531,732 (GRCm39) splice site probably null
R7516:Asph UTSW 4 9,630,940 (GRCm39) missense possibly damaging 0.92
R7517:Asph UTSW 4 9,517,697 (GRCm39) missense probably damaging 1.00
R7736:Asph UTSW 4 9,621,930 (GRCm39) missense possibly damaging 0.81
R7818:Asph UTSW 4 9,475,015 (GRCm39) missense probably damaging 1.00
R8356:Asph UTSW 4 9,537,722 (GRCm39) missense probably benign 0.04
R8456:Asph UTSW 4 9,537,722 (GRCm39) missense probably benign 0.04
R8768:Asph UTSW 4 9,453,417 (GRCm39) missense probably damaging 1.00
R8856:Asph UTSW 4 9,630,947 (GRCm39) missense possibly damaging 0.71
R9024:Asph UTSW 4 9,475,025 (GRCm39) missense probably damaging 1.00
R9125:Asph UTSW 4 9,474,928 (GRCm39) missense possibly damaging 0.58
R9708:Asph UTSW 4 9,542,233 (GRCm39) missense probably damaging 1.00
Z1088:Asph UTSW 4 9,630,715 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTCTCAGAAGTGAAGTGGTGGG -3'
(R):5'- GCTTTGCAGCAGTAAGTGGAG -3'

Sequencing Primer
(F):5'- GGAGGAGGGACCCTGTG -3'
(R):5'- TTGCAGCAGTAAGTGGAGAGGAATC -3'
Posted On 2022-04-18