Incidental Mutation 'R9390:Amn1'
ID 710545
Institutional Source Beutler Lab
Gene Symbol Amn1
Ensembl Gene ENSMUSG00000068250
Gene Name antagonist of mitotic exit network 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R9390 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 149157147-149188712 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 149183485 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 32 (D32E)
Ref Sequence ENSEMBL: ENSMUSP00000092957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095319] [ENSMUST00000111535] [ENSMUST00000141346]
AlphaFold B8JKV0
Predicted Effect probably damaging
Transcript: ENSMUST00000095319
AA Change: D32E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092957
Gene: ENSMUSG00000068250
AA Change: D32E

DomainStartEndE-ValueType
LRR 17 41 2.82e0 SMART
LRR 42 70 1.52e2 SMART
LRR 71 96 1.25e-1 SMART
LRR 97 122 3.89e-3 SMART
LRR 123 147 1.44e1 SMART
LRR 150 175 1.28e1 SMART
Blast:LRR 176 204 3e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111535
AA Change: D75E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107160
Gene: ENSMUSG00000068250
AA Change: D75E

DomainStartEndE-ValueType
LRR 60 84 2.82e0 SMART
LRR 85 113 1.52e2 SMART
LRR 114 139 1.25e-1 SMART
LRR 140 165 3.89e-3 SMART
LRR 166 190 1.44e1 SMART
LRR 193 218 1.28e1 SMART
Blast:LRR 219 247 4e-10 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000141346
AA Change: D32E

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116060
Gene: ENSMUSG00000068250
AA Change: D32E

DomainStartEndE-ValueType
LRR 17 41 2.82e0 SMART
LRR 42 70 1.52e2 SMART
LRR 71 96 1.25e-1 SMART
LRR 97 121 1.44e1 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik A T 16: 91,056,208 S13R probably benign Het
Asph T C 4: 9,635,927 D108G probably damaging Het
BC027072 T C 17: 71,750,988 T565A probably benign Het
C1rb T C 6: 124,580,377 L491P probably damaging Het
Cep120 G A 18: 53,706,912 R759* probably null Het
Chmp6 C T 11: 119,915,462 T38M possibly damaging Het
Comtd1 A G 14: 21,848,799 F25S possibly damaging Het
Dthd1 G A 5: 62,818,561 G193R possibly damaging Het
Dyrk1a T A 16: 94,673,471 S362R probably damaging Het
Ecm2 A G 13: 49,530,316 D590G probably benign Het
Exd1 A T 2: 119,523,699 W293R probably damaging Het
Fam110a C T 2: 151,970,196 R218Q probably benign Het
Fga A T 3: 83,033,303 N755Y probably damaging Het
Fstl4 C A 11: 53,000,275 T80K probably benign Het
Gbp5 A G 3: 142,503,022 K109E probably benign Het
Gucy2g A G 19: 55,202,175 V1009A probably null Het
Herc6 C T 6: 57,625,970 Q545* probably null Het
Hpd T A 5: 123,180,731 probably null Het
Il4 C T 11: 53,614,010 R76H probably damaging Het
Inpp4b T C 8: 81,770,893 V114A probably damaging Het
Ints14 A G 9: 64,984,032 T432A probably benign Het
Isoc1 G A 18: 58,671,278 R126H probably damaging Het
Klb G T 5: 65,375,701 R451L possibly damaging Het
Lrtm2 C T 6: 119,320,987 C31Y probably benign Het
Mga C T 2: 119,963,851 S2672F probably damaging Het
Mkrn3 T C 7: 62,419,540 I168V probably benign Het
Mlph C T 1: 90,939,366 T370I probably benign Het
Naaladl1 A T 19: 6,112,695 I478F probably damaging Het
Neb A T 2: 52,175,145 H6251Q probably benign Het
Nom1 C T 5: 29,434,768 R31C probably benign Het
Nup153 A C 13: 46,687,166 F989V probably damaging Het
Nup188 T C 2: 30,330,765 probably null Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr1259 T C 2: 89,943,225 K297E probably benign Het
Olfr800 A G 10: 129,660,069 T88A probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Pcdhb4 T C 18: 37,309,728 V697A possibly damaging Het
Pds5a G T 5: 65,666,257 Q64K probably benign Het
Pmpcb T C 5: 21,748,812 F353L probably damaging Het
Pus10 G A 11: 23,706,937 C221Y probably damaging Het
Qrfp A G 2: 31,808,737 V61A possibly damaging Het
Runx1t1 A G 4: 13,865,932 I393M probably benign Het
Sh2d5 T G 4: 138,258,170 S310A probably benign Het
Shisa9 A G 16: 12,267,544 E339G possibly damaging Het
Slc26a10 C T 10: 127,173,370 E641K probably benign Het
Slc5a6 A G 5: 31,040,459 V302A possibly damaging Het
Tdrd7 T A 4: 46,005,416 D407E probably damaging Het
Trp53 A T 11: 69,587,568 Q101L probably benign Het
Tsc2 T A 17: 24,604,850 N994Y probably damaging Het
Ttc16 T G 2: 32,767,183 K577Q possibly damaging Het
Vmn1r195 A G 13: 22,278,365 I2V probably benign Het
Vmn2r83 G T 10: 79,481,488 E522* probably null Het
Wdr48 T A 9: 119,917,179 F450L probably benign Het
Wnt9a G A 11: 59,327,766 E100K possibly damaging Het
Zfp729b A T 13: 67,591,063 S1028T probably benign Het
Zfp729b C T 13: 67,593,895 V84I possibly damaging Het
Other mutations in Amn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02391:Amn1 APN 6 149169446 critical splice donor site probably null
PIT4453001:Amn1 UTSW 6 149170859 missense probably benign 0.00
R0153:Amn1 UTSW 6 149188593 utr 5 prime probably benign
R0494:Amn1 UTSW 6 149185136 unclassified probably benign
R0557:Amn1 UTSW 6 149171005 missense possibly damaging 0.50
R0717:Amn1 UTSW 6 149183472 missense possibly damaging 0.88
R0736:Amn1 UTSW 6 149183472 missense possibly damaging 0.88
R3420:Amn1 UTSW 6 149169452 nonsense probably null
R3421:Amn1 UTSW 6 149169452 nonsense probably null
R4466:Amn1 UTSW 6 149166845 splice site probably null
R4760:Amn1 UTSW 6 149185113 missense probably benign
R5294:Amn1 UTSW 6 149185124 unclassified probably benign
R5356:Amn1 UTSW 6 149166894 missense possibly damaging 0.80
R5561:Amn1 UTSW 6 149185024 missense probably damaging 0.98
R7501:Amn1 UTSW 6 149185031 missense probably benign 0.19
R7564:Amn1 UTSW 6 149185031 missense probably benign 0.19
R7643:Amn1 UTSW 6 149185031 missense probably benign 0.19
R7645:Amn1 UTSW 6 149185031 missense probably benign 0.19
R8097:Amn1 UTSW 6 149169355 unclassified probably benign
R9565:Amn1 UTSW 6 149188605 start gained probably benign
X0064:Amn1 UTSW 6 149171035 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCAGGCTGGCCTCAAATT -3'
(R):5'- CCAGGCTGGCCTCAAACTC -3'

Sequencing Primer
(F):5'- AGGCTGGCCTCAAATTTGCAATG -3'
(R):5'- GACACCTGGCCACTTTTT -3'
Posted On 2022-04-18