Incidental Mutation 'R9390:Inpp4b'
ID 710547
Institutional Source Beutler Lab
Gene Symbol Inpp4b
Ensembl Gene ENSMUSG00000037940
Gene Name inositol polyphosphate-4-phosphatase, type II
Synonyms E130107I17Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.230) question?
Stock # R9390 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 82069185-82854543 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 82497522 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 114 (V114A)
Ref Sequence ENSEMBL: ENSMUSP00000150520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042529] [ENSMUST00000109852] [ENSMUST00000169116] [ENSMUST00000169387] [ENSMUST00000170160] [ENSMUST00000172031] [ENSMUST00000213285] [ENSMUST00000215332] [ENSMUST00000217122]
AlphaFold Q6P1Y8
Predicted Effect probably damaging
Transcript: ENSMUST00000042529
AA Change: V114A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044466
Gene: ENSMUSG00000037940
AA Change: V114A

DomainStartEndE-ValueType
C2 40 147 1.72e0 SMART
low complexity region 302 319 N/A INTRINSIC
low complexity region 425 434 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109852
AA Change: V114A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105478
Gene: ENSMUSG00000037940
AA Change: V114A

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
transmembrane domain 915 937 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169116
AA Change: V114A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131947
Gene: ENSMUSG00000037940
AA Change: V114A

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169387
Predicted Effect probably benign
Transcript: ENSMUST00000170160
SMART Domains Protein: ENSMUSP00000132156
Gene: ENSMUSG00000037940

DomainStartEndE-ValueType
low complexity region 134 151 N/A INTRINSIC
low complexity region 257 266 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172031
AA Change: V114A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131324
Gene: ENSMUSG00000037940
AA Change: V114A

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213285
AA Change: V114A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215332
AA Change: V114A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000217122
AA Change: V114A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INPP4B encodes the inositol polyphosphate 4-phosphatase type II, one of the enzymes involved in phosphatidylinositol signaling pathways. This enzyme removes the phosphate group at position 4 of the inositol ring from inositol 3,4-bisphosphate. There is limited data to suggest that the human type II enzyme is subject to alternative splicing, as has been established for the type I enzyme. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit osteoporosis, reduced long bone length, increased osteoclast numbers and size, increased osteoblast numbers, and increased bone resorption and resorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik A T 16: 90,853,096 (GRCm39) S13R probably benign Het
Amn1 A T 6: 149,084,983 (GRCm39) D32E probably damaging Het
Asph T C 4: 9,635,927 (GRCm39) D108G probably damaging Het
C1rb T C 6: 124,557,336 (GRCm39) L491P probably damaging Het
Cep120 G A 18: 53,839,984 (GRCm39) R759* probably null Het
Chmp6 C T 11: 119,806,288 (GRCm39) T38M possibly damaging Het
Comtd1 A G 14: 21,898,867 (GRCm39) F25S possibly damaging Het
Dthd1 G A 5: 62,975,904 (GRCm39) G193R possibly damaging Het
Dyrk1a T A 16: 94,474,330 (GRCm39) S362R probably damaging Het
Ecm2 A G 13: 49,683,792 (GRCm39) D590G probably benign Het
Exd1 A T 2: 119,354,180 (GRCm39) W293R probably damaging Het
Fam110a C T 2: 151,812,116 (GRCm39) R218Q probably benign Het
Fga A T 3: 82,940,610 (GRCm39) N755Y probably damaging Het
Fstl4 C A 11: 52,891,102 (GRCm39) T80K probably benign Het
Gbp5 A G 3: 142,208,783 (GRCm39) K109E probably benign Het
Gucy2g A G 19: 55,190,607 (GRCm39) V1009A probably null Het
Herc6 C T 6: 57,602,955 (GRCm39) Q545* probably null Het
Hpd T A 5: 123,318,794 (GRCm39) probably null Het
Il4 C T 11: 53,504,837 (GRCm39) R76H probably damaging Het
Ints14 A G 9: 64,891,314 (GRCm39) T432A probably benign Het
Isoc1 G A 18: 58,804,350 (GRCm39) R126H probably damaging Het
Klb G T 5: 65,533,044 (GRCm39) R451L possibly damaging Het
Lrtm2 C T 6: 119,297,948 (GRCm39) C31Y probably benign Het
Mga C T 2: 119,794,332 (GRCm39) S2672F probably damaging Het
Mkrn3 T C 7: 62,069,288 (GRCm39) I168V probably benign Het
Mlph C T 1: 90,867,088 (GRCm39) T370I probably benign Het
Naaladl1 A T 19: 6,162,725 (GRCm39) I478F probably damaging Het
Neb A T 2: 52,065,157 (GRCm39) H6251Q probably benign Het
Nom1 C T 5: 29,639,766 (GRCm39) R31C probably benign Het
Nup153 A C 13: 46,840,642 (GRCm39) F989V probably damaging Het
Nup188 T C 2: 30,220,777 (GRCm39) probably null Het
Or4c12 T C 2: 89,773,569 (GRCm39) K297E probably benign Het
Or5aq6 A T 2: 86,923,390 (GRCm39) M117K possibly damaging Het
Or6c210 A G 10: 129,495,938 (GRCm39) T88A probably benign Het
Ovgp1 T C 3: 105,893,883 (GRCm39) probably benign Het
Pcare T C 17: 72,057,983 (GRCm39) T565A probably benign Het
Pcdhb4 T C 18: 37,442,781 (GRCm39) V697A possibly damaging Het
Pds5a G T 5: 65,823,600 (GRCm39) Q64K probably benign Het
Pmpcb T C 5: 21,953,810 (GRCm39) F353L probably damaging Het
Pus10 G A 11: 23,656,937 (GRCm39) C221Y probably damaging Het
Qrfp A G 2: 31,698,749 (GRCm39) V61A possibly damaging Het
Runx1t1 A G 4: 13,865,932 (GRCm39) I393M probably benign Het
Sh2d5 T G 4: 137,985,481 (GRCm39) S310A probably benign Het
Shisa9 A G 16: 12,085,408 (GRCm39) E339G possibly damaging Het
Slc26a10 C T 10: 127,009,239 (GRCm39) E641K probably benign Het
Slc5a6 A G 5: 31,197,803 (GRCm39) V302A possibly damaging Het
Tdrd7 T A 4: 46,005,416 (GRCm39) D407E probably damaging Het
Trp53 A T 11: 69,478,394 (GRCm39) Q101L probably benign Het
Tsc2 T A 17: 24,823,824 (GRCm39) N994Y probably damaging Het
Ttc16 T G 2: 32,657,195 (GRCm39) K577Q possibly damaging Het
Vmn1r195 A G 13: 22,462,535 (GRCm39) I2V probably benign Het
Vmn2r83 G T 10: 79,317,322 (GRCm39) E522* probably null Het
Wdr48 T A 9: 119,746,245 (GRCm39) F450L probably benign Het
Wnt9a G A 11: 59,218,592 (GRCm39) E100K possibly damaging Het
Zfp729b A T 13: 67,739,182 (GRCm39) S1028T probably benign Het
Zfp729b C T 13: 67,742,014 (GRCm39) V84I possibly damaging Het
Other mutations in Inpp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Inpp4b APN 8 82,583,379 (GRCm39) missense probably damaging 1.00
IGL01481:Inpp4b APN 8 82,724,009 (GRCm39) missense probably damaging 1.00
IGL01509:Inpp4b APN 8 82,617,332 (GRCm39) splice site probably benign
IGL01515:Inpp4b APN 8 82,679,340 (GRCm39) missense possibly damaging 0.68
IGL01607:Inpp4b APN 8 82,737,292 (GRCm39) missense probably benign 0.03
IGL01643:Inpp4b APN 8 82,798,400 (GRCm39) missense probably damaging 0.97
IGL01736:Inpp4b APN 8 82,723,968 (GRCm39) missense probably benign 0.00
IGL02154:Inpp4b APN 8 82,696,130 (GRCm39) splice site probably benign
IGL02327:Inpp4b APN 8 82,768,591 (GRCm39) missense probably benign 0.01
IGL02413:Inpp4b APN 8 82,759,800 (GRCm39) missense probably benign
IGL02652:Inpp4b APN 8 82,497,429 (GRCm39) splice site probably benign
IGL02678:Inpp4b APN 8 82,583,373 (GRCm39) missense probably damaging 1.00
IGL03146:Inpp4b APN 8 82,470,410 (GRCm39) missense possibly damaging 0.61
LCD18:Inpp4b UTSW 8 82,419,639 (GRCm39) intron probably benign
PIT4280001:Inpp4b UTSW 8 82,761,046 (GRCm39) missense probably benign 0.00
PIT4480001:Inpp4b UTSW 8 82,772,896 (GRCm39) missense probably damaging 1.00
PIT4504001:Inpp4b UTSW 8 82,768,564 (GRCm39) missense probably damaging 1.00
R0083:Inpp4b UTSW 8 82,468,091 (GRCm39) missense possibly damaging 0.77
R0212:Inpp4b UTSW 8 82,497,546 (GRCm39) missense probably benign 0.00
R0285:Inpp4b UTSW 8 82,761,145 (GRCm39) splice site probably benign
R0363:Inpp4b UTSW 8 82,610,886 (GRCm39) splice site probably benign
R0364:Inpp4b UTSW 8 82,723,943 (GRCm39) missense probably benign 0.09
R0471:Inpp4b UTSW 8 82,768,528 (GRCm39) missense possibly damaging 0.94
R0550:Inpp4b UTSW 8 82,723,966 (GRCm39) missense probably benign 0.00
R0562:Inpp4b UTSW 8 82,494,780 (GRCm39) missense possibly damaging 0.88
R0661:Inpp4b UTSW 8 82,468,091 (GRCm39) missense possibly damaging 0.77
R0693:Inpp4b UTSW 8 82,723,943 (GRCm39) missense probably benign 0.09
R1081:Inpp4b UTSW 8 82,795,653 (GRCm39) missense probably damaging 0.97
R1251:Inpp4b UTSW 8 82,617,382 (GRCm39) missense probably benign 0.01
R1374:Inpp4b UTSW 8 82,470,445 (GRCm39) critical splice donor site probably null
R1445:Inpp4b UTSW 8 82,679,463 (GRCm39) splice site probably null
R1465:Inpp4b UTSW 8 82,494,786 (GRCm39) missense probably damaging 1.00
R1465:Inpp4b UTSW 8 82,494,786 (GRCm39) missense probably damaging 1.00
R1647:Inpp4b UTSW 8 82,583,403 (GRCm39) splice site probably benign
R1754:Inpp4b UTSW 8 82,497,440 (GRCm39) missense probably damaging 1.00
R1759:Inpp4b UTSW 8 82,494,732 (GRCm39) missense probably benign 0.06
R2085:Inpp4b UTSW 8 82,678,903 (GRCm39) missense probably damaging 1.00
R2156:Inpp4b UTSW 8 82,775,118 (GRCm39) missense probably damaging 1.00
R2160:Inpp4b UTSW 8 82,848,004 (GRCm39) nonsense probably null
R2175:Inpp4b UTSW 8 82,583,328 (GRCm39) missense probably damaging 1.00
R2191:Inpp4b UTSW 8 82,723,931 (GRCm39) missense probably damaging 1.00
R2401:Inpp4b UTSW 8 82,723,968 (GRCm39) missense probably benign 0.00
R2475:Inpp4b UTSW 8 82,768,607 (GRCm39) missense probably benign 0.09
R2512:Inpp4b UTSW 8 82,737,179 (GRCm39) missense probably damaging 1.00
R2919:Inpp4b UTSW 8 82,711,958 (GRCm39) missense possibly damaging 0.93
R3021:Inpp4b UTSW 8 82,629,467 (GRCm39) missense possibly damaging 0.47
R3423:Inpp4b UTSW 8 82,678,890 (GRCm39) missense possibly damaging 0.63
R3777:Inpp4b UTSW 8 82,768,621 (GRCm39) missense possibly damaging 0.89
R3778:Inpp4b UTSW 8 82,768,621 (GRCm39) missense possibly damaging 0.89
R3794:Inpp4b UTSW 8 82,759,845 (GRCm39) missense probably damaging 1.00
R3795:Inpp4b UTSW 8 82,759,845 (GRCm39) missense probably damaging 1.00
R4590:Inpp4b UTSW 8 82,468,040 (GRCm39) start codon destroyed probably null 1.00
R4602:Inpp4b UTSW 8 82,696,164 (GRCm39) missense probably damaging 0.99
R4691:Inpp4b UTSW 8 82,849,282 (GRCm39) missense probably damaging 1.00
R4924:Inpp4b UTSW 8 82,849,253 (GRCm39) missense probably damaging 1.00
R4992:Inpp4b UTSW 8 82,759,837 (GRCm39) missense probably damaging 1.00
R5219:Inpp4b UTSW 8 82,610,785 (GRCm39) missense probably benign 0.01
R5228:Inpp4b UTSW 8 82,494,744 (GRCm39) missense probably damaging 0.99
R5557:Inpp4b UTSW 8 82,678,888 (GRCm39) missense probably damaging 0.99
R5627:Inpp4b UTSW 8 82,470,445 (GRCm39) critical splice donor site probably benign
R5691:Inpp4b UTSW 8 82,617,323 (GRCm39) intron probably benign
R6186:Inpp4b UTSW 8 82,772,863 (GRCm39) missense probably damaging 0.99
R6213:Inpp4b UTSW 8 82,724,019 (GRCm39) missense probably damaging 1.00
R6232:Inpp4b UTSW 8 82,678,813 (GRCm39) missense probably damaging 1.00
R6283:Inpp4b UTSW 8 82,497,462 (GRCm39) missense probably damaging 1.00
R6302:Inpp4b UTSW 8 82,494,806 (GRCm39) missense probably benign 0.00
R6309:Inpp4b UTSW 8 82,768,546 (GRCm39) missense probably damaging 1.00
R6360:Inpp4b UTSW 8 82,629,481 (GRCm39) missense probably benign 0.20
R6477:Inpp4b UTSW 8 82,571,343 (GRCm39) splice site probably null
R6773:Inpp4b UTSW 8 82,583,249 (GRCm39) intron probably benign
R6968:Inpp4b UTSW 8 82,571,086 (GRCm39) missense probably benign 0.18
R7147:Inpp4b UTSW 8 82,629,400 (GRCm39) missense probably damaging 1.00
R7318:Inpp4b UTSW 8 82,798,374 (GRCm39) missense probably damaging 1.00
R7409:Inpp4b UTSW 8 82,679,314 (GRCm39) splice site probably null
R7455:Inpp4b UTSW 8 82,798,332 (GRCm39) missense probably damaging 0.99
R7632:Inpp4b UTSW 8 82,772,968 (GRCm39) missense probably damaging 1.00
R7844:Inpp4b UTSW 8 82,467,949 (GRCm39) start gained probably benign
R7958:Inpp4b UTSW 8 82,696,218 (GRCm39) missense probably damaging 1.00
R8440:Inpp4b UTSW 8 82,768,524 (GRCm39) missense probably damaging 1.00
R9160:Inpp4b UTSW 8 82,610,782 (GRCm39) missense possibly damaging 0.55
R9303:Inpp4b UTSW 8 82,759,758 (GRCm39) missense probably damaging 1.00
R9583:Inpp4b UTSW 8 82,497,555 (GRCm39) critical splice donor site probably null
R9705:Inpp4b UTSW 8 82,772,890 (GRCm39) missense probably benign 0.14
R9778:Inpp4b UTSW 8 82,775,160 (GRCm39) missense probably benign
RF003:Inpp4b UTSW 8 82,696,150 (GRCm39) nonsense probably null
Z1088:Inpp4b UTSW 8 82,795,560 (GRCm39) critical splice acceptor site probably null
Z1176:Inpp4b UTSW 8 82,795,630 (GRCm39) missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- GCAGACAGACACACTCTCTG -3'
(R):5'- GCCTAACCAATTGGCATTTTGG -3'

Sequencing Primer
(F):5'- GTGTTCTCATTTGTCCCTGCATG -3'
(R):5'- CCAATTGGCATTTTGGTATCAAGCC -3'
Posted On 2022-04-18