Mutagenetix > Incidental Mutation

Incidental Mutation 'R9390:Cep120'

710571

Institutional Source

Beutler Lab

Gene Symbol

Cep120

Ensembl Gene

ENSMUSG00000048799

Gene Name

centrosomal protein 120

Synonyms

Ccdc100

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.741) question?

Stock #

R9390 (G1)

Quality Score

202.009

Status

Not validated

Chromosome

Chromosomal Location

53681724-53744547 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 53706912 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 759 (R759*)

Ref Sequence

ENSEMBL: ENSMUSP00000062433 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049811]

AlphaFold

Q7TSG1

Predicted Effect

probably null
Transcript: ENSMUST00000049811
AA Change: R759*

SMART Domains

Protein: ENSMUSP00000062433
Gene: ENSMUSG00000048799
AA Change: R759*

Domain	Start	End	E-Value	Type
Pfam:C2	9	114	4.8e-5	PFAM
Pfam:DUF3668	118	340	1e-96	PFAM
low complexity region	378	396	N/A	INTRINSIC
Pfam:C2	520	568	1.9e-3	PFAM
low complexity region	632	642	N/A	INTRINSIC
SCOP:d1eq1a_	661	803	2e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the microtubule-dependent coupling of the nucleus and the centrosome. A similar protein in mouse plays a role in both interkinetic nuclear migration, which is a characteristic pattern of nuclear movement in neural progenitors, and in neural progenitor self-renewal. Mutations in this gene are predicted to result in neurogenic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth arrest at E8.5 and die during organogenesis exhibiting abnormal direction of heart looping. Primary mouse embryonic fibroblasts lack cilia and either one or both centrioles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438H23Rik	A	T	16: 91,056,208	S13R	probably benign	Het
Amn1	A	T	6: 149,183,485	D32E	probably damaging	Het
Asph	T	C	4: 9,635,927	D108G	probably damaging	Het
BC027072	T	C	17: 71,750,988	T565A	probably benign	Het
C1rb	T	C	6: 124,580,377	L491P	probably damaging	Het
Chmp6	C	T	11: 119,915,462	T38M	possibly damaging	Het
Comtd1	A	G	14: 21,848,799	F25S	possibly damaging	Het
Dthd1	G	A	5: 62,818,561	G193R	possibly damaging	Het
Dyrk1a	T	A	16: 94,673,471	S362R	probably damaging	Het
Ecm2	A	G	13: 49,530,316	D590G	probably benign	Het
Exd1	A	T	2: 119,523,699	W293R	probably damaging	Het
Fam110a	C	T	2: 151,970,196	R218Q	probably benign	Het
Fga	A	T	3: 83,033,303	N755Y	probably damaging	Het
Fstl4	C	A	11: 53,000,275	T80K	probably benign	Het
Gbp5	A	G	3: 142,503,022	K109E	probably benign	Het
Gucy2g	A	G	19: 55,202,175	V1009A	probably null	Het
Herc6	C	T	6: 57,625,970	Q545*	probably null	Het
Hpd	T	A	5: 123,180,731		probably null	Het
Il4	C	T	11: 53,614,010	R76H	probably damaging	Het
Inpp4b	T	C	8: 81,770,893	V114A	probably damaging	Het
Ints14	A	G	9: 64,984,032	T432A	probably benign	Het
Isoc1	G	A	18: 58,671,278	R126H	probably damaging	Het
Klb	G	T	5: 65,375,701	R451L	possibly damaging	Het
Lrtm2	C	T	6: 119,320,987	C31Y	probably benign	Het
Mga	C	T	2: 119,963,851	S2672F	probably damaging	Het
Mkrn3	T	C	7: 62,419,540	I168V	probably benign	Het
Mlph	C	T	1: 90,939,366	T370I	probably benign	Het
Naaladl1	A	T	19: 6,112,695	I478F	probably damaging	Het
Neb	A	T	2: 52,175,145	H6251Q	probably benign	Het
Nom1	C	T	5: 29,434,768	R31C	probably benign	Het
Nup153	A	C	13: 46,687,166	F989V	probably damaging	Het
Nup188	T	C	2: 30,330,765		probably null	Het
Olfr1109	A	T	2: 87,093,046	M117K	possibly damaging	Het
Olfr1259	T	C	2: 89,943,225	K297E	probably benign	Het
Olfr800	A	G	10: 129,660,069	T88A	probably benign	Het
Ovgp1	T	C	3: 105,986,567		probably benign	Het
Pcdhb4	T	C	18: 37,309,728	V697A	possibly damaging	Het
Pds5a	G	T	5: 65,666,257	Q64K	probably benign	Het
Pmpcb	T	C	5: 21,748,812	F353L	probably damaging	Het
Pus10	G	A	11: 23,706,937	C221Y	probably damaging	Het
Qrfp	A	G	2: 31,808,737	V61A	possibly damaging	Het
Runx1t1	A	G	4: 13,865,932	I393M	probably benign	Het
Sh2d5	T	G	4: 138,258,170	S310A	probably benign	Het
Shisa9	A	G	16: 12,267,544	E339G	possibly damaging	Het
Slc26a10	C	T	10: 127,173,370	E641K	probably benign	Het
Slc5a6	A	G	5: 31,040,459	V302A	possibly damaging	Het
Tdrd7	T	A	4: 46,005,416	D407E	probably damaging	Het
Trp53	A	T	11: 69,587,568	Q101L	probably benign	Het
Tsc2	T	A	17: 24,604,850	N994Y	probably damaging	Het
Ttc16	T	G	2: 32,767,183	K577Q	possibly damaging	Het
Vmn1r195	A	G	13: 22,278,365	I2V	probably benign	Het
Vmn2r83	G	T	10: 79,481,488	E522*	probably null	Het
Wdr48	T	A	9: 119,917,179	F450L	probably benign	Het
Wnt9a	G	A	11: 59,327,766	E100K	possibly damaging	Het
Zfp729b	C	T	13: 67,593,895	V84I	possibly damaging	Het
Zfp729b	A	T	13: 67,591,063	S1028T	probably benign	Het

Other mutations in Cep120

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01544:Cep120	APN	18	53685961	missense	probably benign	0.24
IGL01774:Cep120	APN	18	53706830	missense	possibly damaging	0.92
IGL01862:Cep120	APN	18	53714767	missense	probably benign	0.01
IGL01906:Cep120	APN	18	53714912	missense	probably benign
IGL01941:Cep120	APN	18	53723148	missense	probably benign	0.00
IGL02952:Cep120	APN	18	53683228	utr 3 prime	probably benign
IGL03248:Cep120	APN	18	53735772	missense	probably benign	0.04
IGL03379:Cep120	APN	18	53709136	missense	probably benign
R0019:Cep120	UTSW	18	53709047	splice site	probably benign
R0039:Cep120	UTSW	18	53685961	missense	probably benign	0.24
R0763:Cep120	UTSW	18	53721737	missense	probably benign	0.00
R1015:Cep120	UTSW	18	53703121	critical splice donor site	probably null
R1340:Cep120	UTSW	18	53724391	missense	probably damaging	1.00
R1507:Cep120	UTSW	18	53697657	missense	probably damaging	0.99
R1649:Cep120	UTSW	18	53724576	missense	probably damaging	1.00
R1727:Cep120	UTSW	18	53727729	missense	probably benign	0.01
R1739:Cep120	UTSW	18	53719214	critical splice donor site	probably null
R1873:Cep120	UTSW	18	53738488	missense	probably damaging	0.98
R1913:Cep120	UTSW	18	53723286	missense	probably benign	0.26
R1968:Cep120	UTSW	18	53723241	missense	probably benign	0.42
R1995:Cep120	UTSW	18	53740136	missense	probably damaging	1.00
R2042:Cep120	UTSW	18	53735742	missense	possibly damaging	0.50
R2074:Cep120	UTSW	18	53719312	missense	possibly damaging	0.83
R2116:Cep120	UTSW	18	53740136	missense	probably damaging	1.00
R2215:Cep120	UTSW	18	53727635	missense	probably damaging	1.00
R2697:Cep120	UTSW	18	53740125	missense	probably benign	0.00
R3813:Cep120	UTSW	18	53740212	splice site	probably benign
R4012:Cep120	UTSW	18	53738582	missense	probably damaging	0.99
R4368:Cep120	UTSW	18	53685885	splice site	probably null
R4615:Cep120	UTSW	18	53714841	missense	probably damaging	1.00
R4772:Cep120	UTSW	18	53718489	missense	probably damaging	1.00
R4780:Cep120	UTSW	18	53724536	missense	probably benign	0.12
R5195:Cep120	UTSW	18	53721698	missense	probably damaging	1.00
R5991:Cep120	UTSW	18	53721798	missense	probably benign
R6156:Cep120	UTSW	18	53703223	missense	probably benign	0.00
R6188:Cep120	UTSW	18	53724457	missense	probably benign	0.03
R6688:Cep120	UTSW	18	53724536	missense	probably benign	0.12
R6961:Cep120	UTSW	18	53703205	nonsense	probably null
R7143:Cep120	UTSW	18	53683385	missense	probably benign	0.00
R7282:Cep120	UTSW	18	53740089	missense	probably damaging	1.00
R7813:Cep120	UTSW	18	53738506	missense	probably damaging	1.00
R7818:Cep120	UTSW	18	53723103	missense	probably benign
R8677:Cep120	UTSW	18	53738561	missense	possibly damaging	0.90
R8724:Cep120	UTSW	18	53723127	missense	possibly damaging	0.88
R9164:Cep120	UTSW	18	53719246	missense	probably benign	0.02
R9225:Cep120	UTSW	18	53706824	missense	probably benign	0.00
R9300:Cep120	UTSW	18	53719297	missense	probably damaging	0.99
R9312:Cep120	UTSW	18	53727641	missense	probably benign	0.08
R9377:Cep120	UTSW	18	53718520	missense	possibly damaging	0.66
R9499:Cep120	UTSW	18	53685961	missense	possibly damaging	0.94
R9551:Cep120	UTSW	18	53685961	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CTCTGGGCAGTGAGTACCA -3'
(R):5'- TGGGATTTCTTGGACCCACCA -3'

Sequencing Primer
(F):5'- GTGAGTACCACAGTCCAAGC -3'
(R):5'- TCTGCGGGTACAGAATTACC -3'

Posted On

2022-04-18