Incidental Mutation 'R9391:Ccdc18'
ID 710587
Institutional Source Beutler Lab
Gene Symbol Ccdc18
Ensembl Gene ENSMUSG00000056531
Gene Name coiled-coil domain containing 18
Synonyms 4932411G06Rik, 1700021E15Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9391 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 108132875-108233628 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108228904 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1404 (F1404L)
Ref Sequence ENSEMBL: ENSMUSP00000036507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047677]
AlphaFold Q640L5
Predicted Effect probably benign
Transcript: ENSMUST00000047677
AA Change: F1404L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000036507
Gene: ENSMUSG00000056531
AA Change: F1404L

DomainStartEndE-ValueType
coiled coil region 109 140 N/A INTRINSIC
coiled coil region 168 320 N/A INTRINSIC
coiled coil region 344 405 N/A INTRINSIC
coiled coil region 507 1307 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik G T 11: 101,990,829 R117I probably benign Het
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Abca5 T C 11: 110,287,716 T1144A probably benign Het
Adam32 C T 8: 24,884,456 E507K probably damaging Het
Adgrf3 T C 5: 30,195,073 E974G possibly damaging Het
Agbl1 A G 7: 76,421,854 E560G unknown Het
Ank2 A T 3: 126,937,745 H671Q probably damaging Het
Asic5 C T 3: 82,021,059 T485M probably benign Het
Bco2 T C 9: 50,534,722 probably null Het
C1qtnf6 A G 15: 78,531,316 C23R unknown Het
Cfap46 A T 7: 139,618,111 I2107N unknown Het
Col15a1 G C 4: 47,288,200 probably benign Het
Cpb2 A C 14: 75,270,696 Q199P probably damaging Het
Dnah7b T A 1: 46,233,754 Y2347* probably null Het
Dyrk1a T A 16: 94,659,514 C10S possibly damaging Het
F2r A T 13: 95,604,148 V293D probably damaging Het
Gm28363 G A 1: 117,698,899 W22* probably null Het
Hira T C 16: 18,949,142 S696P possibly damaging Het
Klhl2 A G 8: 64,823,032 V73A probably damaging Het
Lalba A T 15: 98,482,536 W46R probably damaging Het
Map3k13 C A 16: 21,921,915 T664N probably benign Het
Ncor1 T A 11: 62,325,550 K1166* probably null Het
Npdc1 T A 2: 25,407,967 M176K possibly damaging Het
Obscn A G 11: 59,073,582 S3045P probably damaging Het
Olfr53 G A 7: 140,652,359 A127T probably damaging Het
Plekhg4 G C 8: 105,379,411 K813N probably damaging Het
Prdm12 G A 2: 31,654,150 R255H probably benign Het
Rbbp8 T C 18: 11,721,933 I405T possibly damaging Het
Sctr A G 1: 120,055,448 T328A probably benign Het
Sec63 T A 10: 42,805,105 S362T probably benign Het
Sgsm2 A G 11: 74,853,804 L818P probably damaging Het
Shprh G A 10: 11,162,889 V463I probably benign Het
Smyd5 T C 6: 85,441,757 F241S probably damaging Het
Tax1bp1 T A 6: 52,758,235 Y680* probably null Het
Tbc1d17 A G 7: 44,845,259 S212P probably damaging Het
Tle1 A T 4: 72,197,922 V62E probably damaging Het
Tnfaip3 G T 10: 19,007,327 N163K probably damaging Het
Trim8 T A 19: 46,515,516 Y502* probably null Het
Trip12 A T 1: 84,795,752 F54L probably benign Het
Trpc2 T A 7: 102,095,860 L761Q probably damaging Het
Vps41 A T 13: 18,810,446 E154D probably benign Het
Other mutations in Ccdc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Ccdc18 APN 5 108180525 missense probably benign 0.01
IGL01380:Ccdc18 APN 5 108180887 missense probably damaging 0.96
IGL01405:Ccdc18 APN 5 108202186 splice site probably benign
IGL01718:Ccdc18 APN 5 108201348 missense possibly damaging 0.81
IGL02098:Ccdc18 APN 5 108202111 missense probably damaging 1.00
IGL02227:Ccdc18 APN 5 108148922 missense possibly damaging 0.89
IGL02391:Ccdc18 APN 5 108136052 missense probably damaging 1.00
IGL02794:Ccdc18 APN 5 108171748 missense probably benign 0.00
IGL02808:Ccdc18 APN 5 108135969 splice site probably benign
IGL02880:Ccdc18 APN 5 108135444 missense probably benign 0.31
IGL03069:Ccdc18 APN 5 108228901 missense probably damaging 1.00
IGL03390:Ccdc18 APN 5 108212131 missense probably damaging 1.00
PIT4402001:Ccdc18 UTSW 5 108158619 missense possibly damaging 0.94
R0004:Ccdc18 UTSW 5 108161700 missense possibly damaging 0.52
R0112:Ccdc18 UTSW 5 108173761 missense probably damaging 1.00
R0295:Ccdc18 UTSW 5 108173789 missense probably damaging 1.00
R0546:Ccdc18 UTSW 5 108174964 missense probably benign 0.06
R0619:Ccdc18 UTSW 5 108180416 missense probably benign 0.04
R0648:Ccdc18 UTSW 5 108135560 missense probably damaging 0.99
R0648:Ccdc18 UTSW 5 108174987 missense probably damaging 1.00
R0666:Ccdc18 UTSW 5 108163664 missense probably benign 0.19
R1271:Ccdc18 UTSW 5 108202116 nonsense probably null
R1509:Ccdc18 UTSW 5 108188978 missense possibly damaging 0.89
R1539:Ccdc18 UTSW 5 108191977 missense probably damaging 1.00
R1542:Ccdc18 UTSW 5 108212188 missense probably benign
R1663:Ccdc18 UTSW 5 108216090 missense probably damaging 1.00
R1865:Ccdc18 UTSW 5 108193802 missense probably benign 0.00
R1870:Ccdc18 UTSW 5 108220837 missense possibly damaging 0.90
R1897:Ccdc18 UTSW 5 108196042 missense probably benign 0.00
R1946:Ccdc18 UTSW 5 108228995 missense probably damaging 1.00
R2420:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R2421:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R2422:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R4078:Ccdc18 UTSW 5 108158528 nonsense probably null
R4079:Ccdc18 UTSW 5 108158528 nonsense probably null
R4244:Ccdc18 UTSW 5 108148972 nonsense probably null
R4409:Ccdc18 UTSW 5 108220842 nonsense probably null
R4428:Ccdc18 UTSW 5 108136077 missense probably benign 0.01
R4455:Ccdc18 UTSW 5 108161529 missense possibly damaging 0.68
R4499:Ccdc18 UTSW 5 108228960 missense possibly damaging 0.62
R4612:Ccdc18 UTSW 5 108135441 missense probably benign 0.01
R4907:Ccdc18 UTSW 5 108136141 missense probably benign 0.01
R4972:Ccdc18 UTSW 5 108192003 missense probably benign
R5039:Ccdc18 UTSW 5 108158648 critical splice donor site probably null
R5835:Ccdc18 UTSW 5 108140874 missense possibly damaging 0.94
R5854:Ccdc18 UTSW 5 108206728 missense possibly damaging 0.79
R6128:Ccdc18 UTSW 5 108163759 missense possibly damaging 0.76
R6229:Ccdc18 UTSW 5 108171618 missense probably benign 0.00
R6271:Ccdc18 UTSW 5 108174887 missense possibly damaging 0.65
R6315:Ccdc18 UTSW 5 108161582 missense probably benign
R6359:Ccdc18 UTSW 5 108135525 missense probably damaging 1.00
R6375:Ccdc18 UTSW 5 108174954 missense possibly damaging 0.79
R6388:Ccdc18 UTSW 5 108201348 missense possibly damaging 0.81
R6415:Ccdc18 UTSW 5 108161746 missense probably benign 0.03
R6560:Ccdc18 UTSW 5 108191924 missense probably benign 0.09
R6645:Ccdc18 UTSW 5 108138930 missense probably benign
R6664:Ccdc18 UTSW 5 108168100 nonsense probably null
R6836:Ccdc18 UTSW 5 108197967 missense probably damaging 1.00
R6947:Ccdc18 UTSW 5 108161535 missense probably benign 0.26
R7009:Ccdc18 UTSW 5 108173862 critical splice donor site probably null
R7052:Ccdc18 UTSW 5 108161688 missense probably benign 0.15
R7058:Ccdc18 UTSW 5 108193798 missense probably benign
R7087:Ccdc18 UTSW 5 108196122 missense probably benign
R7117:Ccdc18 UTSW 5 108148969 missense possibly damaging 0.95
R7176:Ccdc18 UTSW 5 108168106 missense probably benign
R7382:Ccdc18 UTSW 5 108139007 missense probably damaging 1.00
R7477:Ccdc18 UTSW 5 108220850 missense probably damaging 0.98
R7493:Ccdc18 UTSW 5 108206617 nonsense probably null
R7506:Ccdc18 UTSW 5 108163739 missense possibly damaging 0.85
R7635:Ccdc18 UTSW 5 108229049 critical splice donor site probably null
R7690:Ccdc18 UTSW 5 108228662 missense probably benign 0.00
R7748:Ccdc18 UTSW 5 108149041 critical splice donor site probably null
R7812:Ccdc18 UTSW 5 108180833 missense probably benign 0.00
R8017:Ccdc18 UTSW 5 108228645 nonsense probably null
R8019:Ccdc18 UTSW 5 108228645 nonsense probably null
R8172:Ccdc18 UTSW 5 108163774 critical splice donor site probably null
R8177:Ccdc18 UTSW 5 108197795 missense possibly damaging 0.65
R8344:Ccdc18 UTSW 5 108161503 missense possibly damaging 0.88
R8351:Ccdc18 UTSW 5 108155797 missense probably damaging 1.00
R8415:Ccdc18 UTSW 5 108216033 missense probably damaging 1.00
R8451:Ccdc18 UTSW 5 108155797 missense probably damaging 1.00
R8547:Ccdc18 UTSW 5 108197859 missense probably damaging 1.00
R8725:Ccdc18 UTSW 5 108180417 missense possibly damaging 0.66
R9137:Ccdc18 UTSW 5 108148990 missense probably damaging 0.98
R9418:Ccdc18 UTSW 5 108155803 missense probably damaging 1.00
R9536:Ccdc18 UTSW 5 108138926 missense probably benign 0.01
R9565:Ccdc18 UTSW 5 108191934 missense probably damaging 0.99
RF013:Ccdc18 UTSW 5 108220716 missense probably benign 0.05
X0024:Ccdc18 UTSW 5 108191922 missense probably benign 0.01
X0063:Ccdc18 UTSW 5 108212197 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAATGCAGAAAACTACGTCGGTC -3'
(R):5'- GGGAGTAAGGATATCCAGCCTAC -3'

Sequencing Primer
(F):5'- AACTACGTCGGTCTATTAGTGCCAG -3'
(R):5'- AGGATATCCAGCCTACAATCTTTCTG -3'
Posted On 2022-04-18