Incidental Mutation 'R9391:Cfap46'
ID 710593
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Name cilia and flagella associated protein 46
Synonyms 9330101J02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9391 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 139600951-139683817 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 139618111 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 2107 (I2107N)
Ref Sequence ENSEMBL: ENSMUSP00000120186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990]
AlphaFold E9Q2C0
Predicted Effect unknown
Transcript: ENSMUST00000129990
AA Change: I2107N
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: I2107N

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik G T 11: 101,990,829 R117I probably benign Het
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Abca5 T C 11: 110,287,716 T1144A probably benign Het
Adam32 C T 8: 24,884,456 E507K probably damaging Het
Adgrf3 T C 5: 30,195,073 E974G possibly damaging Het
Agbl1 A G 7: 76,421,854 E560G unknown Het
Ank2 A T 3: 126,937,745 H671Q probably damaging Het
Asic5 C T 3: 82,021,059 T485M probably benign Het
Bco2 T C 9: 50,534,722 probably null Het
C1qtnf6 A G 15: 78,531,316 C23R unknown Het
Ccdc18 T C 5: 108,228,904 F1404L probably benign Het
Col15a1 G C 4: 47,288,200 probably benign Het
Cpb2 A C 14: 75,270,696 Q199P probably damaging Het
Dnah7b T A 1: 46,233,754 Y2347* probably null Het
Dyrk1a T A 16: 94,659,514 C10S possibly damaging Het
F2r A T 13: 95,604,148 V293D probably damaging Het
Gm28363 G A 1: 117,698,899 W22* probably null Het
Hira T C 16: 18,949,142 S696P possibly damaging Het
Klhl2 A G 8: 64,823,032 V73A probably damaging Het
Lalba A T 15: 98,482,536 W46R probably damaging Het
Map3k13 C A 16: 21,921,915 T664N probably benign Het
Ncor1 T A 11: 62,325,550 K1166* probably null Het
Npdc1 T A 2: 25,407,967 M176K possibly damaging Het
Obscn A G 11: 59,073,582 S3045P probably damaging Het
Olfr53 G A 7: 140,652,359 A127T probably damaging Het
Plekhg4 G C 8: 105,379,411 K813N probably damaging Het
Prdm12 G A 2: 31,654,150 R255H probably benign Het
Rbbp8 T C 18: 11,721,933 I405T possibly damaging Het
Sctr A G 1: 120,055,448 T328A probably benign Het
Sec63 T A 10: 42,805,105 S362T probably benign Het
Sgsm2 A G 11: 74,853,804 L818P probably damaging Het
Shprh G A 10: 11,162,889 V463I probably benign Het
Smyd5 T C 6: 85,441,757 F241S probably damaging Het
Tax1bp1 T A 6: 52,758,235 Y680* probably null Het
Tbc1d17 A G 7: 44,845,259 S212P probably damaging Het
Tle1 A T 4: 72,197,922 V62E probably damaging Het
Tnfaip3 G T 10: 19,007,327 N163K probably damaging Het
Trim8 T A 19: 46,515,516 Y502* probably null Het
Trip12 A T 1: 84,795,752 F54L probably benign Het
Trpc2 T A 7: 102,095,860 L761Q probably damaging Het
Vps41 A T 13: 18,810,446 E154D probably benign Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139614443 missense probably benign 0.06
IGL00505:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139666979 missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139606607 missense unknown
IGL02171:Cfap46 APN 7 139667056 missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139682509 missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139614470 missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139607201 missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139603252 missense unknown
IGL03329:Cfap46 APN 7 139601165 missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139638795 utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139645551 missense
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139654566 missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139651533 splice site probably benign
R0650:Cfap46 UTSW 7 139605655 missense unknown
R0675:Cfap46 UTSW 7 139676034 missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139654670 missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139655841 missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139642597 missense probably benign 0.42
R1251:Cfap46 UTSW 7 139601265 missense probably benign 0.40
R1257:Cfap46 UTSW 7 139654629 nonsense probably null
R1538:Cfap46 UTSW 7 139683008 missense probably null 1.00
R1618:Cfap46 UTSW 7 139652810 missense probably benign 0.04
R1655:Cfap46 UTSW 7 139642520 nonsense probably null
R1824:Cfap46 UTSW 7 139639602 missense probably benign 0.12
R1830:Cfap46 UTSW 7 139640407 missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139653408 missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139683470 missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139679903 missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139667041 missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139683761 missense probably benign 0.03
R2354:Cfap46 UTSW 7 139661046 missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139653498 missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139617590 missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139639599 missense probably benign 0.06
R3949:Cfap46 UTSW 7 139678551 missense probably benign 0.12
R4239:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139652673 missense probably benign 0.27
R4365:Cfap46 UTSW 7 139650952 missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139660082 intron probably benign
R4595:Cfap46 UTSW 7 139652404 missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139657281 missense probably damaging 0.99
R4627:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4628:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139627456 missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139679323 critical splice donor site probably null
R4771:Cfap46 UTSW 7 139630608 missense probably null
R4779:Cfap46 UTSW 7 139659815 intron probably benign
R4812:Cfap46 UTSW 7 139636000 missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139607188 critical splice donor site probably null
R5014:Cfap46 UTSW 7 139627375 missense probably benign 0.12
R5033:Cfap46 UTSW 7 139603860 missense probably benign 0.00
R5055:Cfap46 UTSW 7 139661190 missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139678514 missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139613507 critical splice donor site probably null
R5366:Cfap46 UTSW 7 139650886 missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139627473 missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139632181 splice site probably null
R5642:Cfap46 UTSW 7 139678577 missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139638353 missense probably benign 0.01
R5691:Cfap46 UTSW 7 139606700 missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139612031 missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139650942 missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139651595 missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139656580 missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139661085 missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139680831 missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139614405 critical splice donor site probably null
R6736:Cfap46 UTSW 7 139619971 missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139652440 missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139642561 utr 3 prime probably benign
R6835:Cfap46 UTSW 7 139652498 missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139654561 critical splice donor site probably null
R6912:Cfap46 UTSW 7 139639700 missense probably benign 0.09
R7163:Cfap46 UTSW 7 139618078 critical splice donor site probably null
R7232:Cfap46 UTSW 7 139617577 missense unknown
R7327:Cfap46 UTSW 7 139635146 splice site probably null
R7336:Cfap46 UTSW 7 139620104 missense unknown
R7337:Cfap46 UTSW 7 139630576 critical splice donor site probably null
R7437:Cfap46 UTSW 7 139650837 nonsense probably null
R7450:Cfap46 UTSW 7 139617437 missense unknown
R7495:Cfap46 UTSW 7 139603196 critical splice donor site probably null
R7618:Cfap46 UTSW 7 139603239 missense
R7623:Cfap46 UTSW 7 139618350 missense unknown
R7765:Cfap46 UTSW 7 139651564 missense
R7971:Cfap46 UTSW 7 139635127 missense unknown
R8211:Cfap46 UTSW 7 139633304 missense unknown
R8306:Cfap46 UTSW 7 139656580 missense
R8354:Cfap46 UTSW 7 139653498 missense probably benign 0.03
R8365:Cfap46 UTSW 7 139683084 nonsense probably null
R8447:Cfap46 UTSW 7 139680986 missense possibly damaging 0.90
R8715:Cfap46 UTSW 7 139605644 missense
R8805:Cfap46 UTSW 7 139632063 missense unknown
R8830:Cfap46 UTSW 7 139615649 missense unknown
R8912:Cfap46 UTSW 7 139680181 intron probably benign
R8920:Cfap46 UTSW 7 139652526 missense
R8977:Cfap46 UTSW 7 139679933 missense probably benign 0.01
R9048:Cfap46 UTSW 7 139627343 missense unknown
R9224:Cfap46 UTSW 7 139678500 nonsense probably null
R9252:Cfap46 UTSW 7 139618249 missense unknown
R9276:Cfap46 UTSW 7 139621291 missense unknown
R9301:Cfap46 UTSW 7 139642545 missense
R9402:Cfap46 UTSW 7 139635949 missense unknown
R9443:Cfap46 UTSW 7 139615107 missense
RF023:Cfap46 UTSW 7 139638918
W0251:Cfap46 UTSW 7 139603946 missense probably benign 0.11
X0018:Cfap46 UTSW 7 139680912 missense probably benign 0.03
X0064:Cfap46 UTSW 7 139603447 missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139635064 missense probably damaging 0.96
Z1176:Cfap46 UTSW 7 139639548 missense
Z1177:Cfap46 UTSW 7 139601267 missense unknown
Z1177:Cfap46 UTSW 7 139630626 missense unknown
Predicted Primers PCR Primer
(F):5'- TTAAGGACTAGCTTGGCCTGAGG -3'
(R):5'- TGAAGAGCCCACCTTAGCTTG -3'

Sequencing Primer
(F):5'- AGAACAGGGAGGATCTCTTCTTC -3'
(R):5'- GAGCTTTGCACTGCCCAC -3'
Posted On 2022-04-18