Incidental Mutation 'R9391:Sgsm2'
ID 710604
Institutional Source Beutler Lab
Gene Symbol Sgsm2
Ensembl Gene ENSMUSG00000038351
Gene Name small G protein signaling modulator 2
Synonyms D630003G22Rik, Rutbc1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.362) question?
Stock # R9391 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 74849261-74897060 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74853804 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 818 (L818P)
Ref Sequence ENSEMBL: ENSMUSP00000050496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057631] [ENSMUST00000081799]
AlphaFold Q80U12
Predicted Effect probably damaging
Transcript: ENSMUST00000057631
AA Change: L818P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050496
Gene: ENSMUSG00000038351
AA Change: L818P

DomainStartEndE-ValueType
RUN 128 188 4.3e-18 SMART
low complexity region 453 476 N/A INTRINSIC
TBC 563 965 3.57e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081799
AA Change: L863P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080489
Gene: ENSMUSG00000038351
AA Change: L863P

DomainStartEndE-ValueType
RUN 128 188 4.3e-18 SMART
low complexity region 446 453 N/A INTRINSIC
low complexity region 498 521 N/A INTRINSIC
TBC 608 1010 3.57e-34 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator with activity towards RAB32 and RAB33B, which are regulators of membrane trafficking. The encoded protein inactivates RAB32 and can bind RAB9A-GTP, a protein required for RAB32 activation. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik G T 11: 101,990,829 R117I probably benign Het
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Abca5 T C 11: 110,287,716 T1144A probably benign Het
Adam32 C T 8: 24,884,456 E507K probably damaging Het
Adgrf3 T C 5: 30,195,073 E974G possibly damaging Het
Agbl1 A G 7: 76,421,854 E560G unknown Het
Ank2 A T 3: 126,937,745 H671Q probably damaging Het
Asic5 C T 3: 82,021,059 T485M probably benign Het
Bco2 T C 9: 50,534,722 probably null Het
C1qtnf6 A G 15: 78,531,316 C23R unknown Het
Ccdc18 T C 5: 108,228,904 F1404L probably benign Het
Cfap46 A T 7: 139,618,111 I2107N unknown Het
Col15a1 G C 4: 47,288,200 probably benign Het
Cpb2 A C 14: 75,270,696 Q199P probably damaging Het
Dnah7b T A 1: 46,233,754 Y2347* probably null Het
Dyrk1a T A 16: 94,659,514 C10S possibly damaging Het
F2r A T 13: 95,604,148 V293D probably damaging Het
Gm28363 G A 1: 117,698,899 W22* probably null Het
Hira T C 16: 18,949,142 S696P possibly damaging Het
Klhl2 A G 8: 64,823,032 V73A probably damaging Het
Lalba A T 15: 98,482,536 W46R probably damaging Het
Map3k13 C A 16: 21,921,915 T664N probably benign Het
Ncor1 T A 11: 62,325,550 K1166* probably null Het
Npdc1 T A 2: 25,407,967 M176K possibly damaging Het
Obscn A G 11: 59,073,582 S3045P probably damaging Het
Olfr53 G A 7: 140,652,359 A127T probably damaging Het
Plekhg4 G C 8: 105,379,411 K813N probably damaging Het
Prdm12 G A 2: 31,654,150 R255H probably benign Het
Rbbp8 T C 18: 11,721,933 I405T possibly damaging Het
Sctr A G 1: 120,055,448 T328A probably benign Het
Sec63 T A 10: 42,805,105 S362T probably benign Het
Shprh G A 10: 11,162,889 V463I probably benign Het
Smyd5 T C 6: 85,441,757 F241S probably damaging Het
Tax1bp1 T A 6: 52,758,235 Y680* probably null Het
Tbc1d17 A G 7: 44,845,259 S212P probably damaging Het
Tle1 A T 4: 72,197,922 V62E probably damaging Het
Tnfaip3 G T 10: 19,007,327 N163K probably damaging Het
Trim8 T A 19: 46,515,516 Y502* probably null Het
Trip12 A T 1: 84,795,752 F54L probably benign Het
Trpc2 T A 7: 102,095,860 L761Q probably damaging Het
Vps41 A T 13: 18,810,446 E154D probably benign Het
Other mutations in Sgsm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Sgsm2 APN 11 74853871 missense possibly damaging 0.91
IGL02164:Sgsm2 APN 11 74865416 missense possibly damaging 0.90
IGL02236:Sgsm2 APN 11 74859872 missense probably damaging 1.00
IGL02330:Sgsm2 APN 11 74858667 missense probably benign 0.01
IGL02352:Sgsm2 APN 11 74892074 splice site probably benign
IGL02359:Sgsm2 APN 11 74892074 splice site probably benign
IGL03061:Sgsm2 APN 11 74851136 missense probably damaging 1.00
IGL03180:Sgsm2 APN 11 74868575 critical splice donor site probably null
R0208:Sgsm2 UTSW 11 74868241 missense probably damaging 1.00
R0433:Sgsm2 UTSW 11 74858190 splice site probably null
R0517:Sgsm2 UTSW 11 74867651 missense possibly damaging 0.62
R0755:Sgsm2 UTSW 11 74865497 missense probably damaging 1.00
R1439:Sgsm2 UTSW 11 74869138 missense probably benign 0.34
R1527:Sgsm2 UTSW 11 74853848 nonsense probably null
R1713:Sgsm2 UTSW 11 74896826 missense probably null 0.04
R1962:Sgsm2 UTSW 11 74892028 missense probably damaging 1.00
R2189:Sgsm2 UTSW 11 74853082 missense probably damaging 1.00
R4259:Sgsm2 UTSW 11 74892028 missense probably damaging 1.00
R4261:Sgsm2 UTSW 11 74892028 missense probably damaging 1.00
R4408:Sgsm2 UTSW 11 74851766 missense probably damaging 0.99
R4590:Sgsm2 UTSW 11 74851132 missense probably damaging 1.00
R6137:Sgsm2 UTSW 11 74850851 missense probably damaging 1.00
R6162:Sgsm2 UTSW 11 74892021 missense probably damaging 1.00
R6457:Sgsm2 UTSW 11 74865169 missense possibly damaging 0.77
R6681:Sgsm2 UTSW 11 74865378 missense probably damaging 0.99
R6722:Sgsm2 UTSW 11 74865424 missense probably damaging 1.00
R6986:Sgsm2 UTSW 11 74892041 missense probably damaging 1.00
R7205:Sgsm2 UTSW 11 74854493 missense possibly damaging 0.88
R7209:Sgsm2 UTSW 11 74854325 missense probably damaging 0.98
R7655:Sgsm2 UTSW 11 74865497 missense probably damaging 1.00
R7656:Sgsm2 UTSW 11 74865497 missense probably damaging 1.00
R8526:Sgsm2 UTSW 11 74869021 missense probably benign 0.17
R9112:Sgsm2 UTSW 11 74865396 nonsense probably null
R9184:Sgsm2 UTSW 11 74892008 missense possibly damaging 0.63
R9226:Sgsm2 UTSW 11 74858134 missense possibly damaging 0.72
R9458:Sgsm2 UTSW 11 74868731 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- ACCATCTGATGTGAAGGGCAG -3'
(R):5'- GCATCACTAGAGTTCTGGGTCC -3'

Sequencing Primer
(F):5'- CAGTGGAGTGAAAGACCCC -3'
(R):5'- ATCACTAGAGTTCTGGGTCCTTGTTG -3'
Posted On 2022-04-18