Incidental Mutation 'R9391:Map3k13'
ID 710613
Institutional Source Beutler Lab
Gene Symbol Map3k13
Ensembl Gene ENSMUSG00000033618
Gene Name mitogen-activated protein kinase kinase kinase 13
Synonyms C130026N12Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9391 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 21643923-21752189 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 21740665 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 664 (T664N)
Ref Sequence ENSEMBL: ENSMUSP00000047388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042065] [ENSMUST00000231988] [ENSMUST00000232240]
AlphaFold Q1HKZ5
Predicted Effect probably benign
Transcript: ENSMUST00000042065
AA Change: T664N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047388
Gene: ENSMUSG00000033618
AA Change: T664N

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
Pfam:Pkinase 167 406 3.1e-60 PFAM
Pfam:Pkinase_Tyr 167 406 2.4e-65 PFAM
coiled coil region 456 502 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
low complexity region 805 821 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231988
AA Change: T664N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000232240
AA Change: T664N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase contains a dual leucine-zipper motif, and has been shown to form dimers/oligomers through its leucine-zipper motif. This kinase can phosphorylate and activate MAPK8/JNK, MAP2K7/MKK7, which suggests a role in the JNK signaling pathway. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T C 11: 110,178,542 (GRCm39) T1144A probably benign Het
Adam32 C T 8: 25,374,472 (GRCm39) E507K probably damaging Het
Adgrf3 T C 5: 30,400,071 (GRCm39) E974G possibly damaging Het
Agbl1 A G 7: 76,071,602 (GRCm39) E560G unknown Het
Ank2 A T 3: 126,731,394 (GRCm39) H671Q probably damaging Het
Asic5 C T 3: 81,928,366 (GRCm39) T485M probably benign Het
Bco2 T C 9: 50,446,022 (GRCm39) probably null Het
C1qtnf6 A G 15: 78,415,516 (GRCm39) C23R unknown Het
Ccdc18 T C 5: 108,376,770 (GRCm39) F1404L probably benign Het
Cfap46 A T 7: 139,198,027 (GRCm39) I2107N unknown Het
Cfap97d1 G T 11: 101,881,655 (GRCm39) R117I probably benign Het
Col15a1 G C 4: 47,288,200 (GRCm39) probably benign Het
Cpb2 A C 14: 75,508,136 (GRCm39) Q199P probably damaging Het
Dnah7b T A 1: 46,272,914 (GRCm39) Y2347* probably null Het
Dyrk1a T A 16: 94,460,373 (GRCm39) C10S possibly damaging Het
F2r A T 13: 95,740,656 (GRCm39) V293D probably damaging Het
Gm28363 G A 1: 117,626,629 (GRCm39) W22* probably null Het
Hira T C 16: 18,767,892 (GRCm39) S696P possibly damaging Het
Klhl2 A G 8: 65,275,684 (GRCm39) V73A probably damaging Het
Lalba A T 15: 98,380,417 (GRCm39) W46R probably damaging Het
Ncor1 T A 11: 62,216,376 (GRCm39) K1166* probably null Het
Npdc1 T A 2: 25,297,979 (GRCm39) M176K possibly damaging Het
Obscn A G 11: 58,964,408 (GRCm39) S3045P probably damaging Het
Or13a20 G A 7: 140,232,272 (GRCm39) A127T probably damaging Het
Plekhg4 G C 8: 106,106,043 (GRCm39) K813N probably damaging Het
Pramel39-ps G T 5: 94,451,001 (GRCm39) P375H probably damaging Het
Prdm12 G A 2: 31,544,162 (GRCm39) R255H probably benign Het
Rbbp8 T C 18: 11,854,990 (GRCm39) I405T possibly damaging Het
Sctr A G 1: 119,983,178 (GRCm39) T328A probably benign Het
Sec63 T A 10: 42,681,101 (GRCm39) S362T probably benign Het
Sgsm2 A G 11: 74,744,630 (GRCm39) L818P probably damaging Het
Shprh G A 10: 11,038,633 (GRCm39) V463I probably benign Het
Smyd5 T C 6: 85,418,739 (GRCm39) F241S probably damaging Het
Tax1bp1 T A 6: 52,735,220 (GRCm39) Y680* probably null Het
Tbc1d17 A G 7: 44,494,683 (GRCm39) S212P probably damaging Het
Tle1 A T 4: 72,116,159 (GRCm39) V62E probably damaging Het
Tnfaip3 G T 10: 18,883,075 (GRCm39) N163K probably damaging Het
Trim8 T A 19: 46,503,955 (GRCm39) Y502* probably null Het
Trip12 A T 1: 84,773,473 (GRCm39) F54L probably benign Het
Trpc2 T A 7: 101,745,067 (GRCm39) L761Q probably damaging Het
Vps41 A T 13: 18,994,616 (GRCm39) E154D probably benign Het
Other mutations in Map3k13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Map3k13 APN 16 21,740,514 (GRCm39) missense probably benign 0.00
IGL01092:Map3k13 APN 16 21,746,766 (GRCm39) missense probably damaging 0.97
IGL01958:Map3k13 APN 16 21,710,873 (GRCm39) missense probably benign
IGL02444:Map3k13 APN 16 21,732,982 (GRCm39) missense probably benign 0.19
IGL02503:Map3k13 APN 16 21,727,454 (GRCm39) missense possibly damaging 0.50
IGL02712:Map3k13 APN 16 21,724,005 (GRCm39) missense probably damaging 0.99
IGL03342:Map3k13 APN 16 21,710,981 (GRCm39) missense possibly damaging 0.94
R0086:Map3k13 UTSW 16 21,732,975 (GRCm39) missense probably damaging 0.98
R0124:Map3k13 UTSW 16 21,722,506 (GRCm39) missense possibly damaging 0.95
R0281:Map3k13 UTSW 16 21,732,907 (GRCm39) missense probably damaging 1.00
R0308:Map3k13 UTSW 16 21,710,738 (GRCm39) missense probably benign
R0601:Map3k13 UTSW 16 21,723,999 (GRCm39) missense possibly damaging 0.95
R0669:Map3k13 UTSW 16 21,725,274 (GRCm39) missense probably benign 0.03
R0918:Map3k13 UTSW 16 21,744,990 (GRCm39) missense probably damaging 1.00
R1641:Map3k13 UTSW 16 21,722,542 (GRCm39) missense probably damaging 1.00
R1838:Map3k13 UTSW 16 21,732,939 (GRCm39) missense possibly damaging 0.92
R1891:Map3k13 UTSW 16 21,729,836 (GRCm39) missense probably damaging 1.00
R2125:Map3k13 UTSW 16 21,710,894 (GRCm39) missense probably benign 0.01
R2332:Map3k13 UTSW 16 21,717,427 (GRCm39) splice site probably null
R2361:Map3k13 UTSW 16 21,725,286 (GRCm39) missense probably benign 0.05
R4395:Map3k13 UTSW 16 21,717,321 (GRCm39) missense possibly damaging 0.49
R4505:Map3k13 UTSW 16 21,740,928 (GRCm39) missense probably benign 0.00
R4506:Map3k13 UTSW 16 21,740,928 (GRCm39) missense probably benign 0.00
R4521:Map3k13 UTSW 16 21,724,525 (GRCm39) missense possibly damaging 0.94
R4753:Map3k13 UTSW 16 21,710,752 (GRCm39) missense probably benign
R4952:Map3k13 UTSW 16 21,729,769 (GRCm39) missense probably benign 0.15
R5035:Map3k13 UTSW 16 21,740,421 (GRCm39) missense probably benign 0.03
R5327:Map3k13 UTSW 16 21,740,397 (GRCm39) missense possibly damaging 0.89
R5784:Map3k13 UTSW 16 21,717,391 (GRCm39) missense possibly damaging 0.68
R5831:Map3k13 UTSW 16 21,746,798 (GRCm39) makesense probably null
R5996:Map3k13 UTSW 16 21,723,995 (GRCm39) missense possibly damaging 0.95
R6007:Map3k13 UTSW 16 21,723,933 (GRCm39) missense possibly damaging 0.95
R6546:Map3k13 UTSW 16 21,740,527 (GRCm39) missense probably benign 0.15
R6620:Map3k13 UTSW 16 21,711,061 (GRCm39) missense possibly damaging 0.62
R6683:Map3k13 UTSW 16 21,711,062 (GRCm39) missense probably benign 0.32
R6692:Map3k13 UTSW 16 21,723,987 (GRCm39) missense possibly damaging 0.66
R6695:Map3k13 UTSW 16 21,741,028 (GRCm39) missense probably benign 0.10
R6743:Map3k13 UTSW 16 21,711,173 (GRCm39) missense probably damaging 0.98
R6822:Map3k13 UTSW 16 21,741,013 (GRCm39) missense probably benign 0.00
R6965:Map3k13 UTSW 16 21,740,900 (GRCm39) missense probably benign
R7149:Map3k13 UTSW 16 21,744,187 (GRCm39) missense probably benign 0.04
R7174:Map3k13 UTSW 16 21,745,006 (GRCm39) missense probably damaging 1.00
R7256:Map3k13 UTSW 16 21,710,988 (GRCm39) missense probably benign 0.03
R7400:Map3k13 UTSW 16 21,741,072 (GRCm39) missense probably damaging 1.00
R7733:Map3k13 UTSW 16 21,740,436 (GRCm39) missense probably damaging 1.00
R7848:Map3k13 UTSW 16 21,724,621 (GRCm39) missense probably damaging 0.98
R7871:Map3k13 UTSW 16 21,740,346 (GRCm39) missense probably benign 0.09
R7876:Map3k13 UTSW 16 21,741,069 (GRCm39) missense probably benign 0.00
R8002:Map3k13 UTSW 16 21,723,878 (GRCm39) missense probably benign 0.05
R8089:Map3k13 UTSW 16 21,722,567 (GRCm39) missense possibly damaging 0.48
R8341:Map3k13 UTSW 16 21,740,334 (GRCm39) nonsense probably null
R8738:Map3k13 UTSW 16 21,745,008 (GRCm39) missense probably damaging 1.00
R8940:Map3k13 UTSW 16 21,727,454 (GRCm39) missense possibly damaging 0.50
R8949:Map3k13 UTSW 16 21,723,882 (GRCm39) missense probably benign 0.05
R9749:Map3k13 UTSW 16 21,740,581 (GRCm39) missense probably benign 0.00
R9802:Map3k13 UTSW 16 21,740,518 (GRCm39) missense possibly damaging 0.85
Z1176:Map3k13 UTSW 16 21,723,912 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAGGCAGCCATAGCGACTTC -3'
(R):5'- TCATAGGGTTCAGCCTGACAAC -3'

Sequencing Primer
(F):5'- CGACTTCGCAGCAATCTTG -3'
(R):5'- TGACAACAGCCCCAGGGTC -3'
Posted On 2022-04-18