Incidental Mutation 'R9393:Tespa1'
ID 710687
Institutional Source Beutler Lab
Gene Symbol Tespa1
Ensembl Gene ENSMUSG00000034833
Gene Name thymocyte expressed, positive selection associated 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9393 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 130322870-130364111 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 130347197 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 4 (S4T)
Ref Sequence ENSEMBL: ENSMUSP00000047284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042586] [ENSMUST00000217702] [ENSMUST00000218605]
AlphaFold Q3U132
Predicted Effect probably damaging
Transcript: ENSMUST00000042586
AA Change: S4T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047284
Gene: ENSMUSG00000034833
AA Change: S4T

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
KRAP_IP3R_bind 128 292 2.24e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000217702
AA Change: S4T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000218605
AA Change: S4T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired late thymocyte development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik A G 10: 82,622,641 S59P unknown Het
4933406M09Rik A G 1: 134,390,858 D456G probably benign Het
A2m A G 6: 121,639,311 S133G possibly damaging Het
Agps A G 2: 75,904,912 E567G possibly damaging Het
Ak9 T C 10: 41,409,072 I1381T unknown Het
Apcdd1 C T 18: 62,922,660 probably benign Het
Arrb1 T A 7: 99,589,684 C150S probably damaging Het
Asz1 T C 6: 18,051,331 I450V probably benign Het
Atp10b A G 11: 43,172,781 N181S probably damaging Het
Bptf A C 11: 107,074,308 D1353E probably benign Het
Cacna2d1 T C 5: 15,935,015 M1T probably null Het
Ccdc106 T A 7: 5,056,201 I6N possibly damaging Het
Celf6 A T 9: 59,603,242 Q252L probably benign Het
Colgalt2 A T 1: 152,484,847 K212* probably null Het
Cryba4 T C 5: 112,246,766 S166G probably benign Het
Cyp2w1 A G 5: 139,356,280 E123G probably benign Het
Cyp4a10 G C 4: 115,525,369 K285N probably damaging Het
Cyth1 G T 11: 118,183,884 T197K probably benign Het
Ddhd1 A G 14: 45,657,228 W262R probably damaging Het
Dnah8 T A 17: 30,653,387 V450D possibly damaging Het
Eml5 C T 12: 98,876,174 V222I probably benign Het
Fam160b2 G A 14: 70,594,023 Q24* probably null Het
Fbxw19 A G 9: 109,495,805 S15P probably damaging Het
Fignl2 C A 15: 101,053,585 R272L unknown Het
Gm10842 A T 11: 105,147,059 D56V unknown Het
Gm21818 A T 13: 120,173,422 Y80F probably benign Het
Gmps T A 3: 63,993,219 N305K probably benign Het
Gnai1 A T 5: 18,360,057 L38Q Het
Golim4 A T 3: 75,878,157 D642E probably benign Het
Gp1ba A T 11: 70,640,467 Q353L unknown Het
Gpnmb T C 6: 49,048,062 S343P possibly damaging Het
Hexb G A 13: 97,176,828 R507* probably null Het
Ifitm10 A T 7: 142,370,967 V45D probably damaging Het
Khsrp T C 17: 57,023,350 Y585C probably damaging Het
Kif21a A T 15: 90,969,778 D795E probably benign Het
Klkb1 A T 8: 45,276,355 V309E probably benign Het
Krtap9-1 C A 11: 99,873,838 C133* probably null Het
Krtcap2 T C 3: 89,246,271 probably benign Het
Lilra5 T C 7: 4,237,759 M1T probably null Het
Magi1 G A 6: 93,682,909 T1019I probably benign Het
Mdn1 T A 4: 32,713,825 H1967Q Het
Mroh2b A T 15: 4,951,184 T1412S probably benign Het
Myh13 A T 11: 67,352,068 M936L probably benign Het
Ncapd3 A G 9: 27,051,386 T373A possibly damaging Het
Noc2l T C 4: 156,236,327 probably null Het
Nrg4 C T 9: 55,242,136 S59N probably benign Het
Nrip1 A G 16: 76,294,465 V68A probably benign Het
Olfr739 T C 14: 50,424,798 V93A probably benign Het
Olfr825 T C 10: 130,163,147 T60A probably benign Het
Pcdhga6 G T 18: 37,707,159 probably benign Het
Phf20l1 A G 15: 66,604,106 N196S probably damaging Het
Ppp4r4 T A 12: 103,605,037 Y787* probably null Het
Psma8 G A 18: 14,706,241 R4Q probably null Het
Reg4 A G 3: 98,229,852 K46E probably benign Het
Rnf14 T A 18: 38,309,627 M327K possibly damaging Het
Rtn1 A T 12: 72,216,812 Y753* probably null Het
Slc26a11 A G 11: 119,368,801 R275G probably benign Het
Stard9 A G 2: 120,688,175 T527A possibly damaging Het
Stk26 C T X: 50,841,741 probably benign Het
Tas1r1 C T 4: 152,031,956 C407Y probably damaging Het
Tenm3 A G 8: 48,674,524 S40P probably damaging Het
Tlr11 A G 14: 50,362,090 N511S probably benign Het
Tmem28 C T X: 99,845,491 R321W probably damaging Het
Tmprss15 A G 16: 78,957,323 I1014T probably benign Het
Tpte T A 8: 22,284,974 M20K probably benign Het
Ttn A G 2: 76,782,046 V17199A possibly damaging Het
Tubgcp3 A G 8: 12,653,411 Y305H probably damaging Het
Ubr4 T A 4: 139,485,302 V5081E unknown Het
Unkl T C 17: 25,229,418 S322P probably damaging Het
Vav3 T A 3: 109,578,366 probably null Het
Vmn1r76 A G 7: 11,930,838 S150P probably benign Het
Xpot A G 10: 121,609,695 probably null Het
Xylt1 A G 7: 117,643,679 I650V probably benign Het
Zan C A 5: 137,405,420 A3955S unknown Het
Other mutations in Tespa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Tespa1 APN 10 130355484 missense probably damaging 1.00
R0081:Tespa1 UTSW 10 130360850 missense probably damaging 1.00
R0544:Tespa1 UTSW 10 130360811 missense probably damaging 1.00
R1381:Tespa1 UTSW 10 130360691 missense probably benign 0.45
R1781:Tespa1 UTSW 10 130348250 missense probably benign 0.37
R1912:Tespa1 UTSW 10 130354723 missense probably benign 0.37
R1927:Tespa1 UTSW 10 130348239 missense probably benign 0.01
R2428:Tespa1 UTSW 10 130362075 missense probably damaging 0.99
R3907:Tespa1 UTSW 10 130356797 splice site probably benign
R4439:Tespa1 UTSW 10 130361957 missense probably damaging 1.00
R4440:Tespa1 UTSW 10 130361957 missense probably damaging 1.00
R4441:Tespa1 UTSW 10 130361957 missense probably damaging 1.00
R4836:Tespa1 UTSW 10 130362159 missense probably benign 0.00
R5045:Tespa1 UTSW 10 130362035 nonsense probably null
R5566:Tespa1 UTSW 10 130355487 nonsense probably null
R5670:Tespa1 UTSW 10 130354755 missense probably damaging 0.96
R5691:Tespa1 UTSW 10 130354769 critical splice donor site probably null
R6173:Tespa1 UTSW 10 130347303 missense probably benign 0.08
R7325:Tespa1 UTSW 10 130362041 missense probably damaging 1.00
R7455:Tespa1 UTSW 10 130360690 missense probably benign 0.00
R7577:Tespa1 UTSW 10 130354755 missense probably damaging 0.96
R7783:Tespa1 UTSW 10 130356883 missense probably damaging 1.00
R8048:Tespa1 UTSW 10 130347339 missense probably damaging 1.00
R8719:Tespa1 UTSW 10 130348239 missense probably benign 0.01
R8768:Tespa1 UTSW 10 130362158 missense probably benign 0.19
R8885:Tespa1 UTSW 10 130362447 missense probably benign 0.03
R9695:Tespa1 UTSW 10 130362416 missense probably benign 0.02
Z1176:Tespa1 UTSW 10 130361895 missense probably damaging 0.99
Z1177:Tespa1 UTSW 10 130362430 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATGGCTAAGCATCATTTCTTTCCTG -3'
(R):5'- ATAGCCATCCTGTGCAAGATACAG -3'

Sequencing Primer
(F):5'- CTTTCCTGATTAGGCAGTGAAAAAGC -3'
(R):5'- TCCTGTGCAAGATACAGTAGAC -3'
Posted On 2022-04-18