Incidental Mutation 'R9393:Myh13'
ID 710689
Institutional Source Beutler Lab
Gene Symbol Myh13
Ensembl Gene ENSMUSG00000060180
Gene Name myosin, heavy polypeptide 13, skeletal muscle
Synonyms EO Myosin, extraocular myosin, MyHC-eo
Accession Numbers

Genbank: NM_001081250; MGI: 1339967

Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock # R9393 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 67321658-67371586 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 67352068 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 936 (M936L)
Ref Sequence ENSEMBL: ENSMUSP00000137731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081911] [ENSMUST00000108684] [ENSMUST00000180845]
AlphaFold B1AR69
Predicted Effect probably benign
Transcript: ENSMUST00000081911
AA Change: M936L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080584
Gene: ENSMUSG00000060180
AA Change: M936L

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 8e-13 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
Pfam:Myosin_tail_1 847 1928 4.6e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108684
AA Change: M936L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104324
Gene: ENSMUSG00000060180
AA Change: M936L

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180845
AA Change: M936L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137731
Gene: ENSMUSG00000060180
AA Change: M936L

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik A G 10: 82,622,641 S59P unknown Het
4933406M09Rik A G 1: 134,390,858 D456G probably benign Het
A2m A G 6: 121,639,311 S133G possibly damaging Het
Agps A G 2: 75,904,912 E567G possibly damaging Het
Ak9 T C 10: 41,409,072 I1381T unknown Het
Apcdd1 C T 18: 62,922,660 probably benign Het
Arrb1 T A 7: 99,589,684 C150S probably damaging Het
Asz1 T C 6: 18,051,331 I450V probably benign Het
Atp10b A G 11: 43,172,781 N181S probably damaging Het
Bptf A C 11: 107,074,308 D1353E probably benign Het
Cacna2d1 T C 5: 15,935,015 M1T probably null Het
Ccdc106 T A 7: 5,056,201 I6N possibly damaging Het
Celf6 A T 9: 59,603,242 Q252L probably benign Het
Colgalt2 A T 1: 152,484,847 K212* probably null Het
Cryba4 T C 5: 112,246,766 S166G probably benign Het
Cyp2w1 A G 5: 139,356,280 E123G probably benign Het
Cyp4a10 G C 4: 115,525,369 K285N probably damaging Het
Cyth1 G T 11: 118,183,884 T197K probably benign Het
Ddhd1 A G 14: 45,657,228 W262R probably damaging Het
Dnah8 T A 17: 30,653,387 V450D possibly damaging Het
Eml5 C T 12: 98,876,174 V222I probably benign Het
Fam160b2 G A 14: 70,594,023 Q24* probably null Het
Fbxw19 A G 9: 109,495,805 S15P probably damaging Het
Fignl2 C A 15: 101,053,585 R272L unknown Het
Gm10842 A T 11: 105,147,059 D56V unknown Het
Gm21818 A T 13: 120,173,422 Y80F probably benign Het
Gmps T A 3: 63,993,219 N305K probably benign Het
Gnai1 A T 5: 18,360,057 L38Q Het
Golim4 A T 3: 75,878,157 D642E probably benign Het
Gp1ba A T 11: 70,640,467 Q353L unknown Het
Gpnmb T C 6: 49,048,062 S343P possibly damaging Het
Hexb G A 13: 97,176,828 R507* probably null Het
Ifitm10 A T 7: 142,370,967 V45D probably damaging Het
Khsrp T C 17: 57,023,350 Y585C probably damaging Het
Kif21a A T 15: 90,969,778 D795E probably benign Het
Klkb1 A T 8: 45,276,355 V309E probably benign Het
Krtap9-1 C A 11: 99,873,838 C133* probably null Het
Krtcap2 T C 3: 89,246,271 probably benign Het
Lilra5 T C 7: 4,237,759 M1T probably null Het
Magi1 G A 6: 93,682,909 T1019I probably benign Het
Mdn1 T A 4: 32,713,825 H1967Q Het
Mroh2b A T 15: 4,951,184 T1412S probably benign Het
Ncapd3 A G 9: 27,051,386 T373A possibly damaging Het
Noc2l T C 4: 156,236,327 probably null Het
Nrg4 C T 9: 55,242,136 S59N probably benign Het
Nrip1 A G 16: 76,294,465 V68A probably benign Het
Olfr739 T C 14: 50,424,798 V93A probably benign Het
Olfr825 T C 10: 130,163,147 T60A probably benign Het
Pcdhga6 G T 18: 37,707,159 probably benign Het
Phf20l1 A G 15: 66,604,106 N196S probably damaging Het
Ppp4r4 T A 12: 103,605,037 Y787* probably null Het
Psma8 G A 18: 14,706,241 R4Q probably null Het
Reg4 A G 3: 98,229,852 K46E probably benign Het
Rnf14 T A 18: 38,309,627 M327K possibly damaging Het
Rtn1 A T 12: 72,216,812 Y753* probably null Het
Slc26a11 A G 11: 119,368,801 R275G probably benign Het
Stard9 A G 2: 120,688,175 T527A possibly damaging Het
Stk26 C T X: 50,841,741 probably benign Het
Tas1r1 C T 4: 152,031,956 C407Y probably damaging Het
Tenm3 A G 8: 48,674,524 S40P probably damaging Het
Tespa1 T A 10: 130,347,197 S4T probably damaging Het
Tlr11 A G 14: 50,362,090 N511S probably benign Het
Tmem28 C T X: 99,845,491 R321W probably damaging Het
Tmprss15 A G 16: 78,957,323 I1014T probably benign Het
Tpte T A 8: 22,284,974 M20K probably benign Het
Ttn A G 2: 76,782,046 V17199A possibly damaging Het
Tubgcp3 A G 8: 12,653,411 Y305H probably damaging Het
Ubr4 T A 4: 139,485,302 V5081E unknown Het
Unkl T C 17: 25,229,418 S322P probably damaging Het
Vav3 T A 3: 109,578,366 probably null Het
Vmn1r76 A G 7: 11,930,838 S150P probably benign Het
Xpot A G 10: 121,609,695 probably null Het
Xylt1 A G 7: 117,643,679 I650V probably benign Het
Zan C A 5: 137,405,420 A3955S unknown Het
Other mutations in Myh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Myh13 APN 11 67342488 missense probably damaging 1.00
IGL00808:Myh13 APN 11 67335004 critical splice donor site probably null
IGL00822:Myh13 APN 11 67361328 missense probably damaging 0.98
IGL00823:Myh13 APN 11 67355947 missense probably benign 0.00
IGL00945:Myh13 APN 11 67348006 missense probably null 1.00
IGL01414:Myh13 APN 11 67342472 missense probably benign 0.02
IGL01482:Myh13 APN 11 67352068 missense probably benign
IGL01523:Myh13 APN 11 67347943 missense possibly damaging 0.73
IGL01723:Myh13 APN 11 67369219 unclassified probably benign
IGL01997:Myh13 APN 11 67367166 missense probably benign 0.14
IGL02369:Myh13 APN 11 67360274 unclassified probably benign
IGL02478:Myh13 APN 11 67369378 missense probably benign
IGL02663:Myh13 APN 11 67354927 nonsense probably null
IGL02851:Myh13 APN 11 67348916 missense possibly damaging 0.92
IGL02863:Myh13 APN 11 67332541 missense probably damaging 1.00
IGL02929:Myh13 APN 11 67367165 missense probably damaging 1.00
IGL02979:Myh13 APN 11 67334962 missense possibly damaging 0.72
IGL03065:Myh13 APN 11 67344853 missense probably damaging 0.99
IGL03214:Myh13 APN 11 67353585 missense possibly damaging 0.79
IGL03223:Myh13 APN 11 67350242 missense probably benign 0.39
IGL03231:Myh13 APN 11 67351991 missense possibly damaging 0.94
IGL03407:Myh13 APN 11 67352152 missense probably damaging 1.00
3-1:Myh13 UTSW 11 67351951 splice site probably benign
P0042:Myh13 UTSW 11 67334991 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0379:Myh13 UTSW 11 67369295 unclassified probably benign
R0496:Myh13 UTSW 11 67348815 missense probably damaging 1.00
R0584:Myh13 UTSW 11 67360374 nonsense probably null
R0595:Myh13 UTSW 11 67344846 missense probably benign 0.03
R0621:Myh13 UTSW 11 67341232 missense probably damaging 0.98
R0834:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R0893:Myh13 UTSW 11 67334601 missense probably damaging 1.00
R0964:Myh13 UTSW 11 67345002 missense probably benign 0.02
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0974:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R1028:Myh13 UTSW 11 67356181 missense possibly damaging 0.71
R1112:Myh13 UTSW 11 67354750 missense probably damaging 1.00
R1283:Myh13 UTSW 11 67370921 missense probably damaging 1.00
R1288:Myh13 UTSW 11 67353718 missense probably benign 0.00
R1386:Myh13 UTSW 11 67370950 missense possibly damaging 0.79
R1457:Myh13 UTSW 11 67331046 missense probably damaging 0.97
R1503:Myh13 UTSW 11 67353674 missense probably benign 0.43
R1574:Myh13 UTSW 11 67362581 unclassified probably benign
R1673:Myh13 UTSW 11 67352119 missense possibly damaging 0.79
R1693:Myh13 UTSW 11 67341484 missense possibly damaging 0.95
R1763:Myh13 UTSW 11 67334576 missense probably benign
R2029:Myh13 UTSW 11 67361289 missense probably benign 0.03
R2030:Myh13 UTSW 11 67350238 missense probably benign
R2247:Myh13 UTSW 11 67334558 missense probably damaging 0.96
R2393:Myh13 UTSW 11 67340358 missense possibly damaging 0.93
R2395:Myh13 UTSW 11 67364922 missense probably benign 0.12
R2884:Myh13 UTSW 11 67337643 missense probably benign 0.27
R3696:Myh13 UTSW 11 67345044 missense possibly damaging 0.55
R3786:Myh13 UTSW 11 67327188 missense probably benign 0.01
R3875:Myh13 UTSW 11 67358194 missense probably benign 0.26
R3918:Myh13 UTSW 11 67329238 missense probably benign 0.00
R4061:Myh13 UTSW 11 67330889 missense possibly damaging 0.71
R4160:Myh13 UTSW 11 67364810 intron probably benign
R4183:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R4392:Myh13 UTSW 11 67344881 splice site probably null
R4639:Myh13 UTSW 11 67341551 missense possibly damaging 0.91
R4670:Myh13 UTSW 11 67364738 nonsense probably null
R4783:Myh13 UTSW 11 67341270 missense probably damaging 1.00
R4877:Myh13 UTSW 11 67337651 missense probably damaging 0.99
R5250:Myh13 UTSW 11 67327259 nonsense probably null
R5278:Myh13 UTSW 11 67334564 missense probably benign 0.00
R5371:Myh13 UTSW 11 67344790 splice site probably null
R5479:Myh13 UTSW 11 67348822 missense probably damaging 0.97
R5510:Myh13 UTSW 11 67337723 missense probably benign 0.05
R5690:Myh13 UTSW 11 67329275 missense probably damaging 1.00
R5797:Myh13 UTSW 11 67335002 missense possibly damaging 0.66
R5823:Myh13 UTSW 11 67360468 missense probably damaging 1.00
R5877:Myh13 UTSW 11 67353658 missense possibly damaging 0.78
R6041:Myh13 UTSW 11 67364730 missense probably damaging 1.00
R6175:Myh13 UTSW 11 67354762 missense probably benign 0.00
R6244:Myh13 UTSW 11 67362501 missense probably benign 0.00
R6454:Myh13 UTSW 11 67350365 missense probably benign 0.03
R6617:Myh13 UTSW 11 67361400 missense probably benign 0.00
R6707:Myh13 UTSW 11 67350260 missense probably damaging 1.00
R6747:Myh13 UTSW 11 67350419 missense probably damaging 0.99
R6823:Myh13 UTSW 11 67356158 missense probably benign
R6911:Myh13 UTSW 11 67354927 nonsense probably null
R6997:Myh13 UTSW 11 67327154 nonsense probably null
R7033:Myh13 UTSW 11 67369316 missense possibly damaging 0.92
R7145:Myh13 UTSW 11 67354740 missense probably benign 0.08
R7232:Myh13 UTSW 11 67348846 missense probably damaging 1.00
R7428:Myh13 UTSW 11 67332564 missense probably damaging 1.00
R7448:Myh13 UTSW 11 67364460 critical splice acceptor site probably null
R7474:Myh13 UTSW 11 67327164 missense possibly damaging 0.93
R7474:Myh13 UTSW 11 67367711 missense
R7766:Myh13 UTSW 11 67358329 missense probably benign 0.37
R7809:Myh13 UTSW 11 67350341 missense probably benign 0.14
R7813:Myh13 UTSW 11 67327230 missense probably benign 0.27
R7953:Myh13 UTSW 11 67340380 missense probably damaging 1.00
R8085:Myh13 UTSW 11 67334787 missense probably benign 0.00
R8397:Myh13 UTSW 11 67350287 missense possibly damaging 0.62
R8434:Myh13 UTSW 11 67363185 critical splice acceptor site probably null
R8490:Myh13 UTSW 11 67364525 missense probably damaging 0.98
R8676:Myh13 UTSW 11 67342485 missense probably damaging 1.00
R8681:Myh13 UTSW 11 67352134 missense possibly damaging 0.49
R8777:Myh13 UTSW 11 67361335 missense possibly damaging 0.92
R8777-TAIL:Myh13 UTSW 11 67361335 missense possibly damaging 0.92
R8965:Myh13 UTSW 11 67364606 missense probably benign 0.00
R9088:Myh13 UTSW 11 67352059 missense probably damaging 1.00
R9151:Myh13 UTSW 11 67361323 missense probably damaging 1.00
R9154:Myh13 UTSW 11 67362492 missense probably benign
R9182:Myh13 UTSW 11 67337753 missense probably damaging 1.00
R9332:Myh13 UTSW 11 67363283 missense possibly damaging 0.57
R9446:Myh13 UTSW 11 67364499 missense probably benign 0.01
R9474:Myh13 UTSW 11 67364886 missense
Z1176:Myh13 UTSW 11 67329295 missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67350452 missense possibly damaging 0.55
Z1177:Myh13 UTSW 11 67364591 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTCTCAGCTCAGCTTAGGTGC -3'
(R):5'- CTTCTAGGTGATGAGTGAAGGC -3'

Sequencing Primer
(F):5'- AGGGTCAGGCTCTTTCTTTCCAG -3'
(R):5'- TGATGAGTGAAGGCTGGCG -3'
Posted On 2022-04-18