Mutagenetix > Incidental Mutation

Incidental Mutation 'R9393:Eml5'

710697

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.237) question?

Stock #

R9393 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 98876174 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 222 (V222I)

Ref Sequence

ENSEMBL: ENSMUSP00000152709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]

AlphaFold

Q8BQM8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065716
AA Change: V222I

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: V222I

Domain	Start	End	E-Value	Type
Pfam:HELP	1	49	3.3e-21	PFAM
WD40	50	91	6.42e-1	SMART
WD40	94	136	1.08e-4	SMART
WD40	139	178	1.27e-1	SMART
WD40	184	224	2.75e1	SMART
WD40	225	263	2.65e-4	SMART
Blast:WD40	265	312	2e-22	BLAST
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.2e2	SMART
WD40	397	436	8.59e-1	SMART
WD40	444	479	6.6e1	SMART
WD40	505	546	2.74e2	SMART
WD40	552	592	4.8e-2	SMART
low complexity region	609	632	N/A	INTRINSIC
Pfam:HELP	656	715	1.4e-20	PFAM
WD40	716	757	1.18e-1	SMART
WD40	760	802	2.84e-4	SMART
WD40	805	844	1.91e1	SMART
WD40	853	891	2.64e2	SMART
WD40	892	929	3.45e-3	SMART
WD40	985	1026	4.55e-3	SMART
WD40	1029	1068	6.39e0	SMART
WD40	1071	1111	5.15e-2	SMART
WD40	1180	1221	1.9e2	SMART
WD40	1227	1267	1.38e0	SMART
low complexity region	1280	1297	N/A	INTRINSIC
Pfam:HELP	1335	1410	2.4e-16	PFAM
Blast:WD40	1412	1462	8e-28	BLAST
WD40	1465	1507	1.56e-1	SMART
WD40	1510	1549	2.06e0	SMART
WD40	1558	1597	8.22e1	SMART
WD40	1599	1644	4.26e1	SMART
WD40	1690	1730	2.19e-5	SMART
WD40	1774	1813	5.97e-1	SMART
WD40	1884	1925	2.39e0	SMART
WD40	1931	1971	2.88e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000223282
AA Change: V222I

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190007I07Rik	A	G	10: 82,622,641	S59P	unknown	Het
4933406M09Rik	A	G	1: 134,390,858	D456G	probably benign	Het
A2m	A	G	6: 121,639,311	S133G	possibly damaging	Het
Agps	A	G	2: 75,904,912	E567G	possibly damaging	Het
Ak9	T	C	10: 41,409,072	I1381T	unknown	Het
Apcdd1	C	T	18: 62,922,660		probably benign	Het
Arrb1	T	A	7: 99,589,684	C150S	probably damaging	Het
Asz1	T	C	6: 18,051,331	I450V	probably benign	Het
Atp10b	A	G	11: 43,172,781	N181S	probably damaging	Het
Bptf	A	C	11: 107,074,308	D1353E	probably benign	Het
Cacna2d1	T	C	5: 15,935,015	M1T	probably null	Het
Ccdc106	T	A	7: 5,056,201	I6N	possibly damaging	Het
Celf6	A	T	9: 59,603,242	Q252L	probably benign	Het
Colgalt2	A	T	1: 152,484,847	K212*	probably null	Het
Cryba4	T	C	5: 112,246,766	S166G	probably benign	Het
Cyp2w1	A	G	5: 139,356,280	E123G	probably benign	Het
Cyp4a10	G	C	4: 115,525,369	K285N	probably damaging	Het
Cyth1	G	T	11: 118,183,884	T197K	probably benign	Het
Ddhd1	A	G	14: 45,657,228	W262R	probably damaging	Het
Dnah8	T	A	17: 30,653,387	V450D	possibly damaging	Het
Fam160b2	G	A	14: 70,594,023	Q24*	probably null	Het
Fbxw19	A	G	9: 109,495,805	S15P	probably damaging	Het
Fignl2	C	A	15: 101,053,585	R272L	unknown	Het
Gm10842	A	T	11: 105,147,059	D56V	unknown	Het
Gm21818	A	T	13: 120,173,422	Y80F	probably benign	Het
Gmps	T	A	3: 63,993,219	N305K	probably benign	Het
Gnai1	A	T	5: 18,360,057	L38Q		Het
Golim4	A	T	3: 75,878,157	D642E	probably benign	Het
Gp1ba	A	T	11: 70,640,467	Q353L	unknown	Het
Gpnmb	T	C	6: 49,048,062	S343P	possibly damaging	Het
Hexb	G	A	13: 97,176,828	R507*	probably null	Het
Ifitm10	A	T	7: 142,370,967	V45D	probably damaging	Het
Khsrp	T	C	17: 57,023,350	Y585C	probably damaging	Het
Kif21a	A	T	15: 90,969,778	D795E	probably benign	Het
Klkb1	A	T	8: 45,276,355	V309E	probably benign	Het
Krtap9-1	C	A	11: 99,873,838	C133*	probably null	Het
Krtcap2	T	C	3: 89,246,271		probably benign	Het
Lilra5	T	C	7: 4,237,759	M1T	probably null	Het
Magi1	G	A	6: 93,682,909	T1019I	probably benign	Het
Mdn1	T	A	4: 32,713,825	H1967Q		Het
Mroh2b	A	T	15: 4,951,184	T1412S	probably benign	Het
Myh13	A	T	11: 67,352,068	M936L	probably benign	Het
Ncapd3	A	G	9: 27,051,386	T373A	possibly damaging	Het
Noc2l	T	C	4: 156,236,327		probably null	Het
Nrg4	C	T	9: 55,242,136	S59N	probably benign	Het
Nrip1	A	G	16: 76,294,465	V68A	probably benign	Het
Olfr739	T	C	14: 50,424,798	V93A	probably benign	Het
Olfr825	T	C	10: 130,163,147	T60A	probably benign	Het
Pcdhga6	G	T	18: 37,707,159		probably benign	Het
Phf20l1	A	G	15: 66,604,106	N196S	probably damaging	Het
Ppp4r4	T	A	12: 103,605,037	Y787*	probably null	Het
Psma8	G	A	18: 14,706,241	R4Q	probably null	Het
Reg4	A	G	3: 98,229,852	K46E	probably benign	Het
Rnf14	T	A	18: 38,309,627	M327K	possibly damaging	Het
Rtn1	A	T	12: 72,216,812	Y753*	probably null	Het
Slc26a11	A	G	11: 119,368,801	R275G	probably benign	Het
Stard9	A	G	2: 120,688,175	T527A	possibly damaging	Het
Stk26	C	T	X: 50,841,741		probably benign	Het
Tas1r1	C	T	4: 152,031,956	C407Y	probably damaging	Het
Tenm3	A	G	8: 48,674,524	S40P	probably damaging	Het
Tespa1	T	A	10: 130,347,197	S4T	probably damaging	Het
Tlr11	A	G	14: 50,362,090	N511S	probably benign	Het
Tmem28	C	T	X: 99,845,491	R321W	probably damaging	Het
Tmprss15	A	G	16: 78,957,323	I1014T	probably benign	Het
Tpte	T	A	8: 22,284,974	M20K	probably benign	Het
Ttn	A	G	2: 76,782,046	V17199A	possibly damaging	Het
Tubgcp3	A	G	8: 12,653,411	Y305H	probably damaging	Het
Ubr4	T	A	4: 139,485,302	V5081E	unknown	Het
Unkl	T	C	17: 25,229,418	S322P	probably damaging	Het
Vav3	T	A	3: 109,578,366		probably null	Het
Vmn1r76	A	G	7: 11,930,838	S150P	probably benign	Het
Xpot	A	G	10: 121,609,695		probably null	Het
Xylt1	A	G	7: 117,643,679	I650V	probably benign	Het
Zan	C	A	5: 137,405,420	A3955S	unknown	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
BB010:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
BB020:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1538:Eml5	UTSW	12	98794276	missense	probably damaging	0.99
R1689:Eml5	UTSW	12	98830935	missense	probably damaging	1.00
R1773:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2035:Eml5	UTSW	12	98794266	missense	probably benign	0.33
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2144:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3856:Eml5	UTSW	12	98816024	missense	probably damaging	1.00
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4258:Eml5	UTSW	12	98865434	missense	probably benign	0.01
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4590:Eml5	UTSW	12	98837341	missense	possibly damaging	0.91
R4737:Eml5	UTSW	12	98798852	missense	probably damaging	1.00
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5124:Eml5	UTSW	12	98792042	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5369:Eml5	UTSW	12	98858783	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5832:Eml5	UTSW	12	98876188	missense	probably benign
R6113:Eml5	UTSW	12	98824674	nonsense	probably null
R6131:Eml5	UTSW	12	98861251	missense	probably damaging	0.99
R6175:Eml5	UTSW	12	98794456	missense	possibly damaging	0.69
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6357:Eml5	UTSW	12	98870884	missense	probably damaging	0.98
R6375:Eml5	UTSW	12	98798868
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6657:Eml5	UTSW	12	98791405	missense	probably damaging	0.98
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
R7842:Eml5	UTSW	12	98794135	missense	probably damaging	1.00
R7933:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R8111:Eml5	UTSW	12	98792514	critical splice donor site	probably null
R8198:Eml5	UTSW	12	98858886	nonsense	probably null
R8482:Eml5	UTSW	12	98876301	missense	probably damaging	1.00
R8732:Eml5	UTSW	12	98815959	missense	probably damaging	0.99
R8956:Eml5	UTSW	12	98852693	missense	possibly damaging	0.69
R8975:Eml5	UTSW	12	98810570	missense	probably damaging	0.99
R9131:Eml5	UTSW	12	98858840	missense	probably damaging	1.00
R9258:Eml5	UTSW	12	98844117	missense	possibly damaging	0.77
R9261:Eml5	UTSW	12	98856028	missense	probably damaging	0.99
R9276:Eml5	UTSW	12	98798801	missense	probably damaging	0.99
R9301:Eml5	UTSW	12	98882033	nonsense	probably null
R9368:Eml5	UTSW	12	98796578	missense	probably benign	0.31
R9392:Eml5	UTSW	12	98900940	missense	probably damaging	1.00
R9449:Eml5	UTSW	12	98861295	missense	probably damaging	1.00
R9570:Eml5	UTSW	12	98815984	missense	probably benign	0.15
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAGCTAATCTAGAAACTCTATGG -3'
(R):5'- TAGGCAATTTCTAGCCTGCTACC -3'

Sequencing Primer
(F):5'- TCTGCACTATTCTGAAAAATACACTG -3'
(R):5'- TTTCTAGCCTGCTACCATAGTATAG -3'

Posted On

2022-04-18