Incidental Mutation 'R9393:Mroh2b'
ID 710705
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Name maestro heat-like repeat family member 2B
Synonyms 4930455B06Rik, Heatr7b2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock # R9393 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 4898737-4962205 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 4951184 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 1412 (T1412S)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
AlphaFold Q7M6Y6
Predicted Effect probably benign
Transcript: ENSMUST00000045736
AA Change: T1412S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: T1412S

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik A G 10: 82,622,641 S59P unknown Het
4933406M09Rik A G 1: 134,390,858 D456G probably benign Het
A2m A G 6: 121,639,311 S133G possibly damaging Het
Agps A G 2: 75,904,912 E567G possibly damaging Het
Ak9 T C 10: 41,409,072 I1381T unknown Het
Apcdd1 C T 18: 62,922,660 probably benign Het
Arrb1 T A 7: 99,589,684 C150S probably damaging Het
Asz1 T C 6: 18,051,331 I450V probably benign Het
Atp10b A G 11: 43,172,781 N181S probably damaging Het
Bptf A C 11: 107,074,308 D1353E probably benign Het
Cacna2d1 T C 5: 15,935,015 M1T probably null Het
Ccdc106 T A 7: 5,056,201 I6N possibly damaging Het
Celf6 A T 9: 59,603,242 Q252L probably benign Het
Colgalt2 A T 1: 152,484,847 K212* probably null Het
Cryba4 T C 5: 112,246,766 S166G probably benign Het
Cyp2w1 A G 5: 139,356,280 E123G probably benign Het
Cyp4a10 G C 4: 115,525,369 K285N probably damaging Het
Cyth1 G T 11: 118,183,884 T197K probably benign Het
Ddhd1 A G 14: 45,657,228 W262R probably damaging Het
Dnah8 T A 17: 30,653,387 V450D possibly damaging Het
Eml5 C T 12: 98,876,174 V222I probably benign Het
Fam160b2 G A 14: 70,594,023 Q24* probably null Het
Fbxw19 A G 9: 109,495,805 S15P probably damaging Het
Fignl2 C A 15: 101,053,585 R272L unknown Het
Gm10842 A T 11: 105,147,059 D56V unknown Het
Gm21818 A T 13: 120,173,422 Y80F probably benign Het
Gmps T A 3: 63,993,219 N305K probably benign Het
Gnai1 A T 5: 18,360,057 L38Q Het
Golim4 A T 3: 75,878,157 D642E probably benign Het
Gp1ba A T 11: 70,640,467 Q353L unknown Het
Gpnmb T C 6: 49,048,062 S343P possibly damaging Het
Hexb G A 13: 97,176,828 R507* probably null Het
Ifitm10 A T 7: 142,370,967 V45D probably damaging Het
Khsrp T C 17: 57,023,350 Y585C probably damaging Het
Kif21a A T 15: 90,969,778 D795E probably benign Het
Klkb1 A T 8: 45,276,355 V309E probably benign Het
Krtap9-1 C A 11: 99,873,838 C133* probably null Het
Krtcap2 T C 3: 89,246,271 probably benign Het
Lilra5 T C 7: 4,237,759 M1T probably null Het
Magi1 G A 6: 93,682,909 T1019I probably benign Het
Mdn1 T A 4: 32,713,825 H1967Q Het
Myh13 A T 11: 67,352,068 M936L probably benign Het
Ncapd3 A G 9: 27,051,386 T373A possibly damaging Het
Noc2l T C 4: 156,236,327 probably null Het
Nrg4 C T 9: 55,242,136 S59N probably benign Het
Nrip1 A G 16: 76,294,465 V68A probably benign Het
Olfr739 T C 14: 50,424,798 V93A probably benign Het
Olfr825 T C 10: 130,163,147 T60A probably benign Het
Pcdhga6 G T 18: 37,707,159 probably benign Het
Phf20l1 A G 15: 66,604,106 N196S probably damaging Het
Ppp4r4 T A 12: 103,605,037 Y787* probably null Het
Psma8 G A 18: 14,706,241 R4Q probably null Het
Reg4 A G 3: 98,229,852 K46E probably benign Het
Rnf14 T A 18: 38,309,627 M327K possibly damaging Het
Rtn1 A T 12: 72,216,812 Y753* probably null Het
Slc26a11 A G 11: 119,368,801 R275G probably benign Het
Stard9 A G 2: 120,688,175 T527A possibly damaging Het
Stk26 C T X: 50,841,741 probably benign Het
Tas1r1 C T 4: 152,031,956 C407Y probably damaging Het
Tenm3 A G 8: 48,674,524 S40P probably damaging Het
Tespa1 T A 10: 130,347,197 S4T probably damaging Het
Tlr11 A G 14: 50,362,090 N511S probably benign Het
Tmem28 C T X: 99,845,491 R321W probably damaging Het
Tmprss15 A G 16: 78,957,323 I1014T probably benign Het
Tpte T A 8: 22,284,974 M20K probably benign Het
Ttn A G 2: 76,782,046 V17199A possibly damaging Het
Tubgcp3 A G 8: 12,653,411 Y305H probably damaging Het
Ubr4 T A 4: 139,485,302 V5081E unknown Het
Unkl T C 17: 25,229,418 S322P probably damaging Het
Vav3 T A 3: 109,578,366 probably null Het
Vmn1r76 A G 7: 11,930,838 S150P probably benign Het
Xpot A G 10: 121,609,695 probably null Het
Xylt1 A G 7: 117,643,679 I650V probably benign Het
Zan C A 5: 137,405,420 A3955S unknown Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4945090 missense probably benign 0.08
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R1698:Mroh2b UTSW 15 4914140 missense probably benign 0.02
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4944966 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3750:Mroh2b UTSW 15 4952246 nonsense probably null
R3792:Mroh2b UTSW 15 4923620 missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4904270 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 splice site probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6487:Mroh2b UTSW 15 4947239 missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4905574 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
R7264:Mroh2b UTSW 15 4921362 missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4941554 missense probably benign 0.21
R7462:Mroh2b UTSW 15 4908627 missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4949009 missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4934605 missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4931061 missense probably benign 0.09
R7605:Mroh2b UTSW 15 4945023 missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4917131 missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4949105 missense probably benign 0.36
R7848:Mroh2b UTSW 15 4938379 nonsense probably null
R7952:Mroh2b UTSW 15 4951211 missense probably damaging 1.00
R7995:Mroh2b UTSW 15 4921357 nonsense probably null
R8088:Mroh2b UTSW 15 4900503 missense possibly damaging 0.57
R8207:Mroh2b UTSW 15 4938410 missense possibly damaging 0.95
R8242:Mroh2b UTSW 15 4909040 missense probably benign 0.04
R8248:Mroh2b UTSW 15 4931104 missense probably benign 0.40
R8258:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8259:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8304:Mroh2b UTSW 15 4925637 missense probably damaging 0.99
R8316:Mroh2b UTSW 15 4951264 nonsense probably null
R8345:Mroh2b UTSW 15 4944326 missense probably benign 0.09
R8507:Mroh2b UTSW 15 4949090 missense probably damaging 1.00
R8728:Mroh2b UTSW 15 4905640 missense probably damaging 1.00
R8747:Mroh2b UTSW 15 4935300 missense probably damaging 0.99
R8798:Mroh2b UTSW 15 4948709 missense probably damaging 1.00
R8814:Mroh2b UTSW 15 4941625 missense possibly damaging 0.61
R8856:Mroh2b UTSW 15 4931028 nonsense probably null
R8910:Mroh2b UTSW 15 4931373 missense probably benign 0.01
R8913:Mroh2b UTSW 15 4917528 intron probably benign
R8941:Mroh2b UTSW 15 4962124 missense possibly damaging 0.86
R9014:Mroh2b UTSW 15 4899188 start codon destroyed probably null 0.95
R9086:Mroh2b UTSW 15 4953272 critical splice acceptor site probably null
R9101:Mroh2b UTSW 15 4900453 missense probably benign 0.20
R9118:Mroh2b UTSW 15 4962091 missense possibly damaging 0.86
R9429:Mroh2b UTSW 15 4934425 missense probably damaging 1.00
R9431:Mroh2b UTSW 15 4934470 missense probably damaging 1.00
R9443:Mroh2b UTSW 15 4944339 missense probably damaging 1.00
R9447:Mroh2b UTSW 15 4931341 missense probably damaging 1.00
R9497:Mroh2b UTSW 15 4921363 missense probably damaging 0.98
R9588:Mroh2b UTSW 15 4948648 missense not run
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Z1177:Mroh2b UTSW 15 4905005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTAAAGAGTCCTTGGAATGCAG -3'
(R):5'- AAGGGTGACTTCTGGCCTAG -3'

Sequencing Primer
(F):5'- GAGTGACAAAAATATACCAGTGCTC -3'
(R):5'- TTCAGAGAGAGAAGGCTTATTCATGC -3'
Posted On 2022-04-18