Incidental Mutation 'R9393:Apcdd1'
ID 710717
Institutional Source Beutler Lab
Gene Symbol Apcdd1
Ensembl Gene ENSMUSG00000071847
Gene Name adenomatosis polyposis coli down-regulated 1
Synonyms Drapc1, EIG180
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock # R9393 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 62922327-62953195 bp(+) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) C to T at 62922660 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]
AlphaFold Q3U128
Predicted Effect probably benign
Transcript: ENSMUST00000096554
SMART Domains Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163716
SMART Domains Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik A G 10: 82,622,641 S59P unknown Het
4933406M09Rik A G 1: 134,390,858 D456G probably benign Het
A2m A G 6: 121,639,311 S133G possibly damaging Het
Agps A G 2: 75,904,912 E567G possibly damaging Het
Ak9 T C 10: 41,409,072 I1381T unknown Het
Arrb1 T A 7: 99,589,684 C150S probably damaging Het
Asz1 T C 6: 18,051,331 I450V probably benign Het
Atp10b A G 11: 43,172,781 N181S probably damaging Het
Bptf A C 11: 107,074,308 D1353E probably benign Het
Cacna2d1 T C 5: 15,935,015 M1T probably null Het
Ccdc106 T A 7: 5,056,201 I6N possibly damaging Het
Celf6 A T 9: 59,603,242 Q252L probably benign Het
Colgalt2 A T 1: 152,484,847 K212* probably null Het
Cryba4 T C 5: 112,246,766 S166G probably benign Het
Cyp2w1 A G 5: 139,356,280 E123G probably benign Het
Cyp4a10 G C 4: 115,525,369 K285N probably damaging Het
Cyth1 G T 11: 118,183,884 T197K probably benign Het
Ddhd1 A G 14: 45,657,228 W262R probably damaging Het
Dnah8 T A 17: 30,653,387 V450D possibly damaging Het
Eml5 C T 12: 98,876,174 V222I probably benign Het
Fam160b2 G A 14: 70,594,023 Q24* probably null Het
Fbxw19 A G 9: 109,495,805 S15P probably damaging Het
Fignl2 C A 15: 101,053,585 R272L unknown Het
Gm10842 A T 11: 105,147,059 D56V unknown Het
Gm21818 A T 13: 120,173,422 Y80F probably benign Het
Gmps T A 3: 63,993,219 N305K probably benign Het
Gnai1 A T 5: 18,360,057 L38Q Het
Golim4 A T 3: 75,878,157 D642E probably benign Het
Gp1ba A T 11: 70,640,467 Q353L unknown Het
Gpnmb T C 6: 49,048,062 S343P possibly damaging Het
Hexb G A 13: 97,176,828 R507* probably null Het
Ifitm10 A T 7: 142,370,967 V45D probably damaging Het
Khsrp T C 17: 57,023,350 Y585C probably damaging Het
Kif21a A T 15: 90,969,778 D795E probably benign Het
Klkb1 A T 8: 45,276,355 V309E probably benign Het
Krtap9-1 C A 11: 99,873,838 C133* probably null Het
Krtcap2 T C 3: 89,246,271 probably benign Het
Lilra5 T C 7: 4,237,759 M1T probably null Het
Magi1 G A 6: 93,682,909 T1019I probably benign Het
Mdn1 T A 4: 32,713,825 H1967Q Het
Mroh2b A T 15: 4,951,184 T1412S probably benign Het
Myh13 A T 11: 67,352,068 M936L probably benign Het
Ncapd3 A G 9: 27,051,386 T373A possibly damaging Het
Noc2l T C 4: 156,236,327 probably null Het
Nrg4 C T 9: 55,242,136 S59N probably benign Het
Nrip1 A G 16: 76,294,465 V68A probably benign Het
Olfr739 T C 14: 50,424,798 V93A probably benign Het
Olfr825 T C 10: 130,163,147 T60A probably benign Het
Pcdhga6 G T 18: 37,707,159 probably benign Het
Phf20l1 A G 15: 66,604,106 N196S probably damaging Het
Ppp4r4 T A 12: 103,605,037 Y787* probably null Het
Psma8 G A 18: 14,706,241 R4Q probably null Het
Reg4 A G 3: 98,229,852 K46E probably benign Het
Rnf14 T A 18: 38,309,627 M327K possibly damaging Het
Rtn1 A T 12: 72,216,812 Y753* probably null Het
Slc26a11 A G 11: 119,368,801 R275G probably benign Het
Stard9 A G 2: 120,688,175 T527A possibly damaging Het
Stk26 C T X: 50,841,741 probably benign Het
Tas1r1 C T 4: 152,031,956 C407Y probably damaging Het
Tenm3 A G 8: 48,674,524 S40P probably damaging Het
Tespa1 T A 10: 130,347,197 S4T probably damaging Het
Tlr11 A G 14: 50,362,090 N511S probably benign Het
Tmem28 C T X: 99,845,491 R321W probably damaging Het
Tmprss15 A G 16: 78,957,323 I1014T probably benign Het
Tpte T A 8: 22,284,974 M20K probably benign Het
Ttn A G 2: 76,782,046 V17199A possibly damaging Het
Tubgcp3 A G 8: 12,653,411 Y305H probably damaging Het
Ubr4 T A 4: 139,485,302 V5081E unknown Het
Unkl T C 17: 25,229,418 S322P probably damaging Het
Vav3 T A 3: 109,578,366 probably null Het
Vmn1r76 A G 7: 11,930,838 S150P probably benign Het
Xpot A G 10: 121,609,695 probably null Het
Xylt1 A G 7: 117,643,679 I650V probably benign Het
Zan C A 5: 137,405,420 A3955S unknown Het
Other mutations in Apcdd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Apcdd1 APN 18 62933865 splice site probably benign
IGL01522:Apcdd1 APN 18 62952115 missense possibly damaging 0.50
IGL01637:Apcdd1 APN 18 62937286 missense probably damaging 1.00
IGL02069:Apcdd1 APN 18 62949983 missense probably damaging 1.00
IGL02183:Apcdd1 APN 18 62951854 missense probably damaging 0.98
IGL02268:Apcdd1 APN 18 62950188 missense probably damaging 0.99
IGL02664:Apcdd1 APN 18 62951820 splice site probably benign
R0207:Apcdd1 UTSW 18 62950079 missense probably benign 0.04
R0363:Apcdd1 UTSW 18 62937097 missense possibly damaging 0.46
R0540:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0567:Apcdd1 UTSW 18 62934036 missense possibly damaging 0.93
R0607:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0629:Apcdd1 UTSW 18 62933970 missense probably damaging 1.00
R1118:Apcdd1 UTSW 18 62952024 missense probably benign
R1178:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1180:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1181:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R4363:Apcdd1 UTSW 18 62951932 missense possibly damaging 0.95
R5534:Apcdd1 UTSW 18 62937034 missense probably benign 0.01
R5622:Apcdd1 UTSW 18 62936902 splice site probably null
R5771:Apcdd1 UTSW 18 62936956 missense probably damaging 1.00
R5852:Apcdd1 UTSW 18 62937063 missense probably damaging 1.00
R5934:Apcdd1 UTSW 18 62951869 missense possibly damaging 0.72
R6109:Apcdd1 UTSW 18 62937366 missense probably damaging 1.00
R6515:Apcdd1 UTSW 18 62951839 missense probably damaging 1.00
R6625:Apcdd1 UTSW 18 62951858 missense probably damaging 1.00
R6831:Apcdd1 UTSW 18 62950126 nonsense probably null
R6931:Apcdd1 UTSW 18 62933908 missense probably damaging 1.00
R7018:Apcdd1 UTSW 18 62937049 missense probably damaging 0.98
R7115:Apcdd1 UTSW 18 62936953 missense probably damaging 1.00
R7148:Apcdd1 UTSW 18 62951845 missense probably damaging 1.00
R7326:Apcdd1 UTSW 18 62952188 nonsense probably null
R8025:Apcdd1 UTSW 18 62936908 missense probably damaging 1.00
R8114:Apcdd1 UTSW 18 62950056 missense probably damaging 1.00
R8261:Apcdd1 UTSW 18 62933903 missense possibly damaging 0.86
R8404:Apcdd1 UTSW 18 62933915 missense possibly damaging 0.66
R9015:Apcdd1 UTSW 18 62950086 missense possibly damaging 0.93
R9040:Apcdd1 UTSW 18 62937343 missense probably damaging 0.96
R9288:Apcdd1 UTSW 18 62922660 start gained probably benign
R9295:Apcdd1 UTSW 18 62922660 start gained probably benign
R9297:Apcdd1 UTSW 18 62922660 start gained probably benign
R9317:Apcdd1 UTSW 18 62922660 start gained probably benign
R9319:Apcdd1 UTSW 18 62922660 start gained probably benign
R9394:Apcdd1 UTSW 18 62922660 start gained probably benign
R9396:Apcdd1 UTSW 18 62922660 start gained probably benign
R9397:Apcdd1 UTSW 18 62922660 start gained probably benign
X0028:Apcdd1 UTSW 18 62937130 missense possibly damaging 0.59
Z1088:Apcdd1 UTSW 18 62937183 missense probably benign 0.18
Z1177:Apcdd1 UTSW 18 62922691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGTACCTCTGAGCTGTGC -3'
(R):5'- AGGTTCGCATCCTTCCAGAAAG -3'

Sequencing Primer
(F):5'- TCTGAGCTGTGCACGCC -3'
(R):5'- AAAACCACTGCGGGTGC -3'
Posted On 2022-04-18