Mutagenetix > Incidental Mutations

Incidental Mutation 'R9393:Apcdd1'

710717

Institutional Source

Beutler Lab

Gene Symbol

Apcdd1

Ensembl Gene

ENSMUSG00000071847

Gene Name

adenomatosis polyposis coli down-regulated 1

Synonyms

Drapc1, EIG180

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.173) question?

Stock #

R9393 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

62922327-62953195 bp(+) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

C to T at 62922660 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000125868 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]

AlphaFold

Q3U128

Predicted Effect

probably benign
Transcript: ENSMUST00000096554

SMART Domains

Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163716

SMART Domains

Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190007I07Rik	A	G	10: 82,622,641	S59P	unknown	Het
4933406M09Rik	A	G	1: 134,390,858	D456G	probably benign	Het
A2m	A	G	6: 121,639,311	S133G	possibly damaging	Het
Agps	A	G	2: 75,904,912	E567G	possibly damaging	Het
Ak9	T	C	10: 41,409,072	I1381T	unknown	Het
Arrb1	T	A	7: 99,589,684	C150S	probably damaging	Het
Asz1	T	C	6: 18,051,331	I450V	probably benign	Het
Atp10b	A	G	11: 43,172,781	N181S	probably damaging	Het
Bptf	A	C	11: 107,074,308	D1353E	probably benign	Het
Cacna2d1	T	C	5: 15,935,015	M1T	probably null	Het
Ccdc106	T	A	7: 5,056,201	I6N	possibly damaging	Het
Celf6	A	T	9: 59,603,242	Q252L	probably benign	Het
Colgalt2	A	T	1: 152,484,847	K212*	probably null	Het
Cryba4	T	C	5: 112,246,766	S166G	probably benign	Het
Cyp2w1	A	G	5: 139,356,280	E123G	probably benign	Het
Cyp4a10	G	C	4: 115,525,369	K285N	probably damaging	Het
Cyth1	G	T	11: 118,183,884	T197K	probably benign	Het
Ddhd1	A	G	14: 45,657,228	W262R	probably damaging	Het
Dnah8	T	A	17: 30,653,387	V450D	possibly damaging	Het
Eml5	C	T	12: 98,876,174	V222I	probably benign	Het
Fam160b2	G	A	14: 70,594,023	Q24*	probably null	Het
Fbxw19	A	G	9: 109,495,805	S15P	probably damaging	Het
Fignl2	C	A	15: 101,053,585	R272L	unknown	Het
Gm10842	A	T	11: 105,147,059	D56V	unknown	Het
Gm21818	A	T	13: 120,173,422	Y80F	probably benign	Het
Gmps	T	A	3: 63,993,219	N305K	probably benign	Het
Gnai1	A	T	5: 18,360,057	L38Q		Het
Golim4	A	T	3: 75,878,157	D642E	probably benign	Het
Gp1ba	A	T	11: 70,640,467	Q353L	unknown	Het
Gpnmb	T	C	6: 49,048,062	S343P	possibly damaging	Het
Hexb	G	A	13: 97,176,828	R507*	probably null	Het
Ifitm10	A	T	7: 142,370,967	V45D	probably damaging	Het
Khsrp	T	C	17: 57,023,350	Y585C	probably damaging	Het
Kif21a	A	T	15: 90,969,778	D795E	probably benign	Het
Klkb1	A	T	8: 45,276,355	V309E	probably benign	Het
Krtap9-1	C	A	11: 99,873,838	C133*	probably null	Het
Krtcap2	T	C	3: 89,246,271		probably benign	Het
Lilra5	T	C	7: 4,237,759	M1T	probably null	Het
Magi1	G	A	6: 93,682,909	T1019I	probably benign	Het
Mdn1	T	A	4: 32,713,825	H1967Q		Het
Mroh2b	A	T	15: 4,951,184	T1412S	probably benign	Het
Myh13	A	T	11: 67,352,068	M936L	probably benign	Het
Ncapd3	A	G	9: 27,051,386	T373A	possibly damaging	Het
Noc2l	T	C	4: 156,236,327		probably null	Het
Nrg4	C	T	9: 55,242,136	S59N	probably benign	Het
Nrip1	A	G	16: 76,294,465	V68A	probably benign	Het
Olfr739	T	C	14: 50,424,798	V93A	probably benign	Het
Olfr825	T	C	10: 130,163,147	T60A	probably benign	Het
Pcdhga6	G	T	18: 37,707,159		probably benign	Het
Phf20l1	A	G	15: 66,604,106	N196S	probably damaging	Het
Ppp4r4	T	A	12: 103,605,037	Y787*	probably null	Het
Psma8	G	A	18: 14,706,241	R4Q	probably null	Het
Reg4	A	G	3: 98,229,852	K46E	probably benign	Het
Rnf14	T	A	18: 38,309,627	M327K	possibly damaging	Het
Rtn1	A	T	12: 72,216,812	Y753*	probably null	Het
Slc26a11	A	G	11: 119,368,801	R275G	probably benign	Het
Stard9	A	G	2: 120,688,175	T527A	possibly damaging	Het
Stk26	C	T	X: 50,841,741		probably benign	Het
Tas1r1	C	T	4: 152,031,956	C407Y	probably damaging	Het
Tenm3	A	G	8: 48,674,524	S40P	probably damaging	Het
Tespa1	T	A	10: 130,347,197	S4T	probably damaging	Het
Tlr11	A	G	14: 50,362,090	N511S	probably benign	Het
Tmem28	C	T	X: 99,845,491	R321W	probably damaging	Het
Tmprss15	A	G	16: 78,957,323	I1014T	probably benign	Het
Tpte	T	A	8: 22,284,974	M20K	probably benign	Het
Ttn	A	G	2: 76,782,046	V17199A	possibly damaging	Het
Tubgcp3	A	G	8: 12,653,411	Y305H	probably damaging	Het
Ubr4	T	A	4: 139,485,302	V5081E	unknown	Het
Unkl	T	C	17: 25,229,418	S322P	probably damaging	Het
Vav3	T	A	3: 109,578,366		probably null	Het
Vmn1r76	A	G	7: 11,930,838	S150P	probably benign	Het
Xpot	A	G	10: 121,609,695		probably null	Het
Xylt1	A	G	7: 117,643,679	I650V	probably benign	Het
Zan	C	A	5: 137,405,420	A3955S	unknown	Het

Other mutations in Apcdd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00805:Apcdd1	APN	18	62933865	splice site	probably benign
IGL01522:Apcdd1	APN	18	62952115	missense	possibly damaging	0.50
IGL01637:Apcdd1	APN	18	62937286	missense	probably damaging	1.00
IGL02069:Apcdd1	APN	18	62949983	missense	probably damaging	1.00
IGL02183:Apcdd1	APN	18	62951854	missense	probably damaging	0.98
IGL02268:Apcdd1	APN	18	62950188	missense	probably damaging	0.99
IGL02664:Apcdd1	APN	18	62951820	splice site	probably benign
R0207:Apcdd1	UTSW	18	62950079	missense	probably benign	0.04
R0363:Apcdd1	UTSW	18	62937097	missense	possibly damaging	0.46
R0540:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0567:Apcdd1	UTSW	18	62934036	missense	possibly damaging	0.93
R0607:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0629:Apcdd1	UTSW	18	62933970	missense	probably damaging	1.00
R1118:Apcdd1	UTSW	18	62952024	missense	probably benign
R1178:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1180:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1181:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R4363:Apcdd1	UTSW	18	62951932	missense	possibly damaging	0.95
R5534:Apcdd1	UTSW	18	62937034	missense	probably benign	0.01
R5622:Apcdd1	UTSW	18	62936902	splice site	probably null
R5771:Apcdd1	UTSW	18	62936956	missense	probably damaging	1.00
R5852:Apcdd1	UTSW	18	62937063	missense	probably damaging	1.00
R5934:Apcdd1	UTSW	18	62951869	missense	possibly damaging	0.72
R6109:Apcdd1	UTSW	18	62937366	missense	probably damaging	1.00
R6515:Apcdd1	UTSW	18	62951839	missense	probably damaging	1.00
R6625:Apcdd1	UTSW	18	62951858	missense	probably damaging	1.00
R6831:Apcdd1	UTSW	18	62950126	nonsense	probably null
R6931:Apcdd1	UTSW	18	62933908	missense	probably damaging	1.00
R7018:Apcdd1	UTSW	18	62937049	missense	probably damaging	0.98
R7115:Apcdd1	UTSW	18	62936953	missense	probably damaging	1.00
R7148:Apcdd1	UTSW	18	62951845	missense	probably damaging	1.00
R7326:Apcdd1	UTSW	18	62952188	nonsense	probably null
R8025:Apcdd1	UTSW	18	62936908	missense	probably damaging	1.00
R8114:Apcdd1	UTSW	18	62950056	missense	probably damaging	1.00
R8261:Apcdd1	UTSW	18	62933903	missense	possibly damaging	0.86
R8404:Apcdd1	UTSW	18	62933915	missense	possibly damaging	0.66
R9015:Apcdd1	UTSW	18	62950086	missense	possibly damaging	0.93
R9040:Apcdd1	UTSW	18	62937343	missense	probably damaging	0.96
R9288:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9295:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9297:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9317:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9319:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9394:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9396:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9397:Apcdd1	UTSW	18	62922660	start gained	probably benign
X0028:Apcdd1	UTSW	18	62937130	missense	possibly damaging	0.59
Z1088:Apcdd1	UTSW	18	62937183	missense	probably benign	0.18
Z1177:Apcdd1	UTSW	18	62922691	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACTGTACCTCTGAGCTGTGC -3'
(R):5'- AGGTTCGCATCCTTCCAGAAAG -3'

Sequencing Primer
(F):5'- TCTGAGCTGTGCACGCC -3'
(R):5'- AAAACCACTGCGGGTGC -3'

Posted On

2022-04-18