Mutagenetix > Incidental Mutation

Incidental Mutation 'R9394:Rnf123'

710746

Institutional Source

Beutler Lab

Gene Symbol

Rnf123

Ensembl Gene

ENSMUSG00000041528

Gene Name

ring finger protein 123

Synonyms

KPC1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.174) question?

Stock #

R9394 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

108051534-108083346 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 108065706 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 611 (H611R)

Ref Sequence

ENSEMBL: ENSMUSP00000125745 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000162355] [ENSMUST00000178267]

AlphaFold

Q5XPI3

Predicted Effect

probably damaging
Transcript: ENSMUST00000047746
AA Change: H611R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: H611R

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160249
AA Change: H611R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: H611R

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160649
AA Change: H611R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: H611R

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000162355
AA Change: H611R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: H611R

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000178267
AA Change: H611R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: H611R

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl1	A	G	4: 86,216,988	D78G		Het
Adgrv1	A	G	13: 81,476,648	V3734A	possibly damaging	Het
Alpk1	T	A	3: 127,672,538	E1106D	probably damaging	Het
Apc2	A	G	10: 80,309,172	Y639C	probably damaging	Het
Apcdd1	C	T	18: 62,922,660		probably benign	Het
Arfgef2	G	A	2: 166,834,549	V119I	probably benign	Het
Cacna2d1	T	C	5: 15,935,015	M1T	probably null	Het
Cfap52	A	G	11: 67,925,095	*621R	probably null	Het
Ddx58	T	C	4: 40,213,831	N609S	probably damaging	Het
Dis3l	T	C	9: 64,317,735	I427V	probably benign	Het
Dscaml1	G	A	9: 45,750,056	V1751I	possibly damaging	Het
Eif3c	A	T	7: 126,557,378	F432L	probably benign	Het
Gm2000	T	C	1: 156,366,223	V49A	probably benign	Het
Iars	A	G	13: 49,730,060	N1110S	probably benign	Het
Ifitm10	A	T	7: 142,370,967	V45D	probably damaging	Het
Igfbpl1	A	T	4: 45,826,792	M1K	probably null	Het
Igkv3-1	T	A	6: 70,703,969	Y51N	probably benign	Het
Kcnq2	A	T	2: 181,082,424	I600K	probably benign	Het
Madd	G	A	2: 91,169,854	T569M	probably benign	Het
Mapk7	A	T	11: 61,491,032	H351Q	probably damaging	Het
Met	A	C	6: 17,513,396	Y415S	probably damaging	Het
Mmd2	A	T	5: 142,569,484	V151D	probably damaging	Het
Nacad	T	C	11: 6,599,390	D1267G	probably damaging	Het
Olfr1135	T	C	2: 87,671,750	I206V	probably benign	Het
Olfr1510	A	G	14: 52,410,113	V253A	probably damaging	Het
Olfr165	A	G	16: 19,407,269	V249A	probably benign	Het
Olfr166	A	C	16: 19,487,671	T278P	possibly damaging	Het
Osbpl8	C	T	10: 111,291,514	R820*	probably null	Het
Oxsr1	C	A	9: 119,322,068	E3*	probably null	Het
Plekhg3	A	G	12: 76,577,088	D1035G	probably damaging	Het
Prune2	C	T	19: 17,003,689	T70I	probably damaging	Het
Ranbp2	T	C	10: 58,455,876	L235S	probably damaging	Het
Rasal1	A	C	5: 120,678,681	S761R	probably benign	Het
Rims1	T	C	1: 22,472,775	S566G	probably damaging	Het
Scn5a	T	A	9: 119,495,616	N1382I	probably damaging	Het
Sgcb	T	C	5: 73,644,310	I71V	probably benign	Het
Slc6a20a	C	A	9: 123,678,740	V23L	probably damaging	Het
Slc7a1	A	G	5: 148,333,902	W585R	probably damaging	Het
Stk26	C	T	X: 50,841,741		probably benign	Het
Tom1l2	T	C	11: 60,241,889	T403A	probably benign	Het
Trpm1	G	T	7: 64,268,732	A1491S	probably benign	Het
Ttn	A	C	2: 76,876,714	D9044E	unknown	Het
Ube3a	A	T	7: 59,272,212	K111*	probably null	Het
Wee2	A	G	6: 40,456,944	H264R	probably damaging	Het
Zdhhc23	T	A	16: 43,971,463	I316F	probably damaging	Het
Zfc3h1	A	G	10: 115,418,695	E1398G	probably damaging	Het
Zfp612	C	A	8: 110,084,361	P57T	probably damaging	Het

Other mutations in Rnf123

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Rnf123	APN	9	108067395	critical splice donor site	probably null
IGL01358:Rnf123	APN	9	108069182	missense	probably damaging	1.00
IGL01464:Rnf123	APN	9	108052302	missense	probably damaging	1.00
IGL01637:Rnf123	APN	9	108058238	missense	probably damaging	1.00
IGL01669:Rnf123	APN	9	108058356	missense	probably damaging	0.98
IGL01905:Rnf123	APN	9	108071370	splice site	probably benign
IGL02070:Rnf123	APN	9	108068302	nonsense	probably null
IGL02072:Rnf123	APN	9	108068302	nonsense	probably null
IGL02073:Rnf123	APN	9	108068302	nonsense	probably null
IGL02074:Rnf123	APN	9	108066889	missense	probably damaging	1.00
IGL02079:Rnf123	APN	9	108068302	nonsense	probably null
IGL02080:Rnf123	APN	9	108068302	nonsense	probably null
IGL02231:Rnf123	APN	9	108066399	missense	probably benign	0.17
IGL02281:Rnf123	APN	9	108071452	missense	probably benign	0.01
IGL02336:Rnf123	APN	9	108061842	missense	probably damaging	1.00
IGL02543:Rnf123	APN	9	108066348	missense	probably damaging	1.00
IGL02565:Rnf123	APN	9	108052212	critical splice donor site	probably null
IGL02571:Rnf123	APN	9	108068302	nonsense	probably null
IGL02572:Rnf123	APN	9	108068302	nonsense	probably null
IGL02574:Rnf123	APN	9	108068302	nonsense	probably null
IGL02586:Rnf123	APN	9	108068302	nonsense	probably null
IGL02589:Rnf123	APN	9	108068302	nonsense	probably null
IGL02600:Rnf123	APN	9	108068302	nonsense	probably null
IGL02601:Rnf123	APN	9	108068302	nonsense	probably null
IGL02602:Rnf123	APN	9	108068302	nonsense	probably null
IGL02603:Rnf123	APN	9	108068302	nonsense	probably null
IGL02609:Rnf123	APN	9	108068302	nonsense	probably null
IGL02628:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108070789	splice site	probably benign
IGL02630:Rnf123	APN	9	108068302	nonsense	probably null
IGL02631:Rnf123	APN	9	108068302	nonsense	probably null
IGL02632:Rnf123	APN	9	108068302	nonsense	probably null
IGL02650:Rnf123	APN	9	108069748	missense	probably benign	0.29
IGL02690:Rnf123	APN	9	108068302	nonsense	probably null
IGL02691:Rnf123	APN	9	108068302	nonsense	probably null
IGL02692:Rnf123	APN	9	108068302	nonsense	probably null
IGL02693:Rnf123	APN	9	108068302	nonsense	probably null
IGL02713:Rnf123	APN	9	108068302	nonsense	probably null
IGL02736:Rnf123	APN	9	108068302	nonsense	probably null
IGL02929:Rnf123	APN	9	108069076	missense	probably benign
R1175:Rnf123	UTSW	9	108077373	missense	probably benign
R1465:Rnf123	UTSW	9	108071466	splice site	probably benign
R1502:Rnf123	UTSW	9	108068510	splice site	probably null
R1682:Rnf123	UTSW	9	108077398	missense	probably benign	0.16
R1817:Rnf123	UTSW	9	108062926	missense	probably benign	0.41
R1855:Rnf123	UTSW	9	108061791	missense	probably damaging	1.00
R2394:Rnf123	UTSW	9	108063536	missense	probably benign	0.00
R2483:Rnf123	UTSW	9	108063521	missense	probably benign	0.16
R3896:Rnf123	UTSW	9	108069103	splice site	probably benign
R3940:Rnf123	UTSW	9	108064035	splice site	probably benign
R4206:Rnf123	UTSW	9	108063963	missense	probably benign	0.01
R4641:Rnf123	UTSW	9	108058587	missense	probably damaging	1.00
R4714:Rnf123	UTSW	9	108052439	splice site	probably null
R4767:Rnf123	UTSW	9	108052089	missense	probably damaging	1.00
R4849:Rnf123	UTSW	9	108056091	missense	probably damaging	1.00
R4899:Rnf123	UTSW	9	108063680	missense	probably damaging	1.00
R5274:Rnf123	UTSW	9	108064003	frame shift	probably null
R5275:Rnf123	UTSW	9	108064003	frame shift	probably null
R5276:Rnf123	UTSW	9	108064003	frame shift	probably null
R5294:Rnf123	UTSW	9	108064003	frame shift	probably null
R5295:Rnf123	UTSW	9	108064003	frame shift	probably null
R5394:Rnf123	UTSW	9	108070731	missense	probably damaging	1.00
R5717:Rnf123	UTSW	9	108067424	missense	probably damaging	1.00
R6186:Rnf123	UTSW	9	108069958	missense	possibly damaging	0.55
R6449:Rnf123	UTSW	9	108056053	missense	probably benign	0.17
R6502:Rnf123	UTSW	9	108068332	missense	possibly damaging	0.46
R6944:Rnf123	UTSW	9	108063623	missense	probably benign	0.02
R7003:Rnf123	UTSW	9	108063683	critical splice acceptor site	probably null
R7088:Rnf123	UTSW	9	108058536	missense	probably null	1.00
R7092:Rnf123	UTSW	9	108068600	missense	probably benign	0.07
R7100:Rnf123	UTSW	9	108056639	missense	probably damaging	1.00
R7257:Rnf123	UTSW	9	108069029	missense	probably damaging	1.00
R7453:Rnf123	UTSW	9	108070408	splice site	probably null
R7468:Rnf123	UTSW	9	108069009	missense	probably benign	0.00
R7517:Rnf123	UTSW	9	108070274	nonsense	probably null
R7577:Rnf123	UTSW	9	108070619	missense	probably damaging	1.00
R8296:Rnf123	UTSW	9	108062890	missense	probably damaging	1.00
R8322:Rnf123	UTSW	9	108068507	missense	probably benign	0.26
R8754:Rnf123	UTSW	9	108071164	missense	probably damaging	1.00
R8783:Rnf123	UTSW	9	108069073	missense	probably benign
R9052:Rnf123	UTSW	9	108059731	missense	probably damaging	1.00
R9156:Rnf123	UTSW	9	108063028	splice site	probably benign
R9170:Rnf123	UTSW	9	108071176	missense	probably damaging	1.00
R9332:Rnf123	UTSW	9	108067505	missense	probably benign	0.00
R9385:Rnf123	UTSW	9	108052268	missense	probably benign	0.02
R9432:Rnf123	UTSW	9	108059809	missense	probably damaging	0.96
R9717:Rnf123	UTSW	9	108077764	missense	probably benign	0.43
Z1176:Rnf123	UTSW	9	108058395	missense	probably damaging	1.00
Z1176:Rnf123	UTSW	9	108062981	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTGGCTAAACAGGAGATC -3'
(R):5'- AGTAACCAGCTGCCAAGAATTC -3'

Sequencing Primer
(F):5'- GATCAGATACAGCCTAGCAGGTC -3'
(R):5'- ACCCCAAGTTCTACAGTTGTTGG -3'

Posted On

2022-04-18