Incidental Mutation 'R9394:Apcdd1'
ID 710765
Institutional Source Beutler Lab
Gene Symbol Apcdd1
Ensembl Gene ENSMUSG00000071847
Gene Name adenomatosis polyposis coli down-regulated 1
Synonyms Drapc1, EIG180
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock # R9394 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 62922327-62953195 bp(+) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) C to T at 62922660 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]
AlphaFold Q3U128
Predicted Effect probably benign
Transcript: ENSMUST00000096554
SMART Domains Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163716
SMART Domains Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A G 4: 86,216,988 D78G Het
Adgrv1 A G 13: 81,476,648 V3734A possibly damaging Het
Alpk1 T A 3: 127,672,538 E1106D probably damaging Het
Apc2 A G 10: 80,309,172 Y639C probably damaging Het
Arfgef2 G A 2: 166,834,549 V119I probably benign Het
Cacna2d1 T C 5: 15,935,015 M1T probably null Het
Cfap52 A G 11: 67,925,095 *621R probably null Het
Ddx58 T C 4: 40,213,831 N609S probably damaging Het
Dis3l T C 9: 64,317,735 I427V probably benign Het
Dscaml1 G A 9: 45,750,056 V1751I possibly damaging Het
Eif3c A T 7: 126,557,378 F432L probably benign Het
Gm2000 T C 1: 156,366,223 V49A probably benign Het
Iars A G 13: 49,730,060 N1110S probably benign Het
Ifitm10 A T 7: 142,370,967 V45D probably damaging Het
Igfbpl1 A T 4: 45,826,792 M1K probably null Het
Igkv3-1 T A 6: 70,703,969 Y51N probably benign Het
Kcnq2 A T 2: 181,082,424 I600K probably benign Het
Madd G A 2: 91,169,854 T569M probably benign Het
Mapk7 A T 11: 61,491,032 H351Q probably damaging Het
Met A C 6: 17,513,396 Y415S probably damaging Het
Mmd2 A T 5: 142,569,484 V151D probably damaging Het
Nacad T C 11: 6,599,390 D1267G probably damaging Het
Olfr1135 T C 2: 87,671,750 I206V probably benign Het
Olfr1510 A G 14: 52,410,113 V253A probably damaging Het
Olfr165 A G 16: 19,407,269 V249A probably benign Het
Olfr166 A C 16: 19,487,671 T278P possibly damaging Het
Osbpl8 C T 10: 111,291,514 R820* probably null Het
Oxsr1 C A 9: 119,322,068 E3* probably null Het
Plekhg3 A G 12: 76,577,088 D1035G probably damaging Het
Prune2 C T 19: 17,003,689 T70I probably damaging Het
Ranbp2 T C 10: 58,455,876 L235S probably damaging Het
Rasal1 A C 5: 120,678,681 S761R probably benign Het
Rims1 T C 1: 22,472,775 S566G probably damaging Het
Rnf123 T C 9: 108,065,706 H611R probably damaging Het
Scn5a T A 9: 119,495,616 N1382I probably damaging Het
Sgcb T C 5: 73,644,310 I71V probably benign Het
Slc6a20a C A 9: 123,678,740 V23L probably damaging Het
Slc7a1 A G 5: 148,333,902 W585R probably damaging Het
Stk26 C T X: 50,841,741 probably benign Het
Tom1l2 T C 11: 60,241,889 T403A probably benign Het
Trpm1 G T 7: 64,268,732 A1491S probably benign Het
Ttn A C 2: 76,876,714 D9044E unknown Het
Ube3a A T 7: 59,272,212 K111* probably null Het
Wee2 A G 6: 40,456,944 H264R probably damaging Het
Zdhhc23 T A 16: 43,971,463 I316F probably damaging Het
Zfc3h1 A G 10: 115,418,695 E1398G probably damaging Het
Zfp612 C A 8: 110,084,361 P57T probably damaging Het
Other mutations in Apcdd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Apcdd1 APN 18 62933865 splice site probably benign
IGL01522:Apcdd1 APN 18 62952115 missense possibly damaging 0.50
IGL01637:Apcdd1 APN 18 62937286 missense probably damaging 1.00
IGL02069:Apcdd1 APN 18 62949983 missense probably damaging 1.00
IGL02183:Apcdd1 APN 18 62951854 missense probably damaging 0.98
IGL02268:Apcdd1 APN 18 62950188 missense probably damaging 0.99
IGL02664:Apcdd1 APN 18 62951820 splice site probably benign
R0207:Apcdd1 UTSW 18 62950079 missense probably benign 0.04
R0363:Apcdd1 UTSW 18 62937097 missense possibly damaging 0.46
R0540:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0567:Apcdd1 UTSW 18 62934036 missense possibly damaging 0.93
R0607:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0629:Apcdd1 UTSW 18 62933970 missense probably damaging 1.00
R1118:Apcdd1 UTSW 18 62952024 missense probably benign
R1178:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1180:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1181:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R4363:Apcdd1 UTSW 18 62951932 missense possibly damaging 0.95
R5534:Apcdd1 UTSW 18 62937034 missense probably benign 0.01
R5622:Apcdd1 UTSW 18 62936902 splice site probably null
R5771:Apcdd1 UTSW 18 62936956 missense probably damaging 1.00
R5852:Apcdd1 UTSW 18 62937063 missense probably damaging 1.00
R5934:Apcdd1 UTSW 18 62951869 missense possibly damaging 0.72
R6109:Apcdd1 UTSW 18 62937366 missense probably damaging 1.00
R6515:Apcdd1 UTSW 18 62951839 missense probably damaging 1.00
R6625:Apcdd1 UTSW 18 62951858 missense probably damaging 1.00
R6831:Apcdd1 UTSW 18 62950126 nonsense probably null
R6931:Apcdd1 UTSW 18 62933908 missense probably damaging 1.00
R7018:Apcdd1 UTSW 18 62937049 missense probably damaging 0.98
R7115:Apcdd1 UTSW 18 62936953 missense probably damaging 1.00
R7148:Apcdd1 UTSW 18 62951845 missense probably damaging 1.00
R7326:Apcdd1 UTSW 18 62952188 nonsense probably null
R8025:Apcdd1 UTSW 18 62936908 missense probably damaging 1.00
R8114:Apcdd1 UTSW 18 62950056 missense probably damaging 1.00
R8261:Apcdd1 UTSW 18 62933903 missense possibly damaging 0.86
R8404:Apcdd1 UTSW 18 62933915 missense possibly damaging 0.66
R9015:Apcdd1 UTSW 18 62950086 missense possibly damaging 0.93
R9040:Apcdd1 UTSW 18 62937343 missense probably damaging 0.96
R9288:Apcdd1 UTSW 18 62922660 start gained probably benign
R9295:Apcdd1 UTSW 18 62922660 start gained probably benign
R9297:Apcdd1 UTSW 18 62922660 start gained probably benign
R9317:Apcdd1 UTSW 18 62922660 start gained probably benign
R9319:Apcdd1 UTSW 18 62922660 start gained probably benign
R9393:Apcdd1 UTSW 18 62922660 start gained probably benign
R9396:Apcdd1 UTSW 18 62922660 start gained probably benign
R9397:Apcdd1 UTSW 18 62922660 start gained probably benign
X0028:Apcdd1 UTSW 18 62937130 missense possibly damaging 0.59
Z1088:Apcdd1 UTSW 18 62937183 missense probably benign 0.18
Z1177:Apcdd1 UTSW 18 62922691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTACCTCTGAGCTGTGCAC -3'
(R):5'- AGAGGTTCGCATCCTTCCAG -3'

Sequencing Primer
(F):5'- GCTGCGGTTCGGAGTCC -3'
(R):5'- GGTTCGCATCCTTCCAGAAAGAAC -3'
Posted On 2022-04-18