Incidental Mutation 'R9396:Cdk5rap2'
ID 710818
Institutional Source Beutler Lab
Gene Symbol Cdk5rap2
Ensembl Gene ENSMUSG00000039298
Gene Name CDK5 regulatory subunit associated protein 2
Synonyms 2900018K03Rik, an
MMRRC Submission
Accession Numbers

Genbank: NM_145990.3
Essential gene? Possibly non essential (E-score: 0.383) question?
Stock # R9396 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 70216856-70410443 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 70264658 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 1268 (S1268N)
Ref Sequence ENSEMBL: ENSMUSP00000119891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000138561] [ENSMUST00000144099]
AlphaFold Q8K389
Predicted Effect probably benign
Transcript: ENSMUST00000076541
Predicted Effect probably damaging
Transcript: ENSMUST00000138561
AA Change: S8N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116928
Gene: ENSMUSG00000039298
AA Change: S8N

DomainStartEndE-ValueType
Blast:BRLZ 228 284 1e-13 BLAST
low complexity region 297 314 N/A INTRINSIC
low complexity region 368 386 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144099
AA Change: S1268N

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298
AA Change: S1268N

DomainStartEndE-ValueType
Pfam:Cnn_1N 58 130 3.6e-26 PFAM
coiled coil region 210 345 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
coiled coil region 388 462 N/A INTRINSIC
coiled coil region 569 616 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
coiled coil region 960 1001 N/A INTRINSIC
coiled coil region 1112 1140 N/A INTRINSIC
coiled coil region 1200 1237 N/A INTRINSIC
Blast:BRLZ 1479 1535 6e-13 BLAST
low complexity region 1548 1565 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
low complexity region 1811 1822 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T A 17: 84,692,854 F281I probably damaging Het
Acad8 A G 9: 26,975,745 M402T probably damaging Het
Apcdd1 C T 18: 62,922,660 probably benign Het
Apol7a T C 15: 77,389,725 E179G possibly damaging Het
Asmt A G X: 170,676,406 T217A probably benign Het
Cadm2 T C 16: 66,747,216 Y318C probably damaging Het
Cckar G A 5: 53,707,281 T26M probably damaging Het
Cd300ld G A 11: 114,987,404 T94I probably damaging Het
Csrnp3 C T 2: 66,002,497 R127C probably damaging Het
Dsc2 T A 18: 20,041,716 R501* probably null Het
Dusp2 C T 2: 127,337,718 R294C probably damaging Het
Edrf1 A G 7: 133,660,109 K878E possibly damaging Het
Evc T C 5: 37,319,090 T372A possibly damaging Het
Fcgr1 T A 3: 96,287,074 K166* probably null Het
Fstl4 C A 11: 52,773,951 P36Q probably benign Het
Gas2l2 A T 11: 83,422,833 I551N probably benign Het
Hc G T 2: 35,037,603 S333* probably null Het
Ibsp A G 5: 104,310,431 Y278C probably damaging Het
Ifitm10 A T 7: 142,370,967 V45D probably damaging Het
Kcnc3 T C 7: 44,591,513 S210P possibly damaging Het
Klhl3 T G 13: 58,013,848 T531P probably damaging Het
Mapt C A 11: 104,298,729 P191Q possibly damaging Het
Mpp5 G T 12: 78,824,747 R367L possibly damaging Het
Myh9 T C 15: 77,763,296 T1840A probably benign Het
Myof A T 19: 37,934,846 C1320S probably damaging Het
Myom3 G T 4: 135,785,888 V626L probably benign Het
Ndor1 A G 2: 25,248,909 L321P probably benign Het
Nhsl1 T A 10: 18,524,001 M291K probably damaging Het
Nubp2 C T 17: 24,884,502 V134I probably benign Het
Nuf2 T C 1: 169,510,348 I287V probably benign Het
Olfr1066 A T 2: 86,455,501 C257S probably benign Het
Olfr1290 A G 2: 111,489,519 L213P probably benign Het
Olfr134 T A 17: 38,175,530 W149R probably damaging Het
Olfr195 G A 16: 59,148,939 V30M probably damaging Het
Olfr412 T A 11: 74,365,263 M198K probably benign Het
Olfr544 A C 7: 102,484,973 V49G possibly damaging Het
Olfr641 A G 7: 104,040,513 N239S probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp1r12a A G 10: 108,264,710 E863G probably damaging Het
Pskh1 C T 8: 105,913,459 T257M possibly damaging Het
Rasgef1b T C 5: 99,229,329 I334V probably benign Het
Rnf180 T A 13: 105,181,519 K462* probably null Het
Sin3a A G 9: 57,101,161 D455G probably benign Het
Slc15a4 A G 5: 127,617,399 probably benign Het
Slc2a13 T C 15: 91,343,712 T426A probably benign Het
Smarca5 T C 8: 80,736,729 K70R probably benign Het
Smg1 A G 7: 118,208,080 V182A unknown Het
Stim1 G A 7: 102,415,385 V221I possibly damaging Het
Tbx18 T C 9: 87,727,379 D201G probably damaging Het
Tcf25 A G 8: 123,401,092 E630G probably benign Het
Tm7sf3 T C 6: 146,621,974 N135S possibly damaging Het
Tmem28 C T X: 99,845,491 R321W probably damaging Het
Togaram1 A G 12: 64,967,655 N560S probably damaging Het
Unc13d A G 11: 116,075,703 probably null Het
Zfp445 A C 9: 122,852,516 S787A probably benign Het
Zfp949 T C 9: 88,567,207 W22R probably damaging Het
Other mutations in Cdk5rap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdk5rap2 APN 4 70403472 critical splice donor site probably null
IGL01305:Cdk5rap2 APN 4 70380235 missense possibly damaging 0.52
IGL01987:Cdk5rap2 APN 4 70302082 critical splice donor site probably null
IGL02213:Cdk5rap2 APN 4 70317602 splice site probably benign
IGL02732:Cdk5rap2 APN 4 70266665 nonsense probably null
IGL03063:Cdk5rap2 APN 4 70354877 critical splice acceptor site probably null
IGL03244:Cdk5rap2 APN 4 70281435 missense probably benign 0.19
ANU22:Cdk5rap2 UTSW 4 70380235 missense possibly damaging 0.52
F5426:Cdk5rap2 UTSW 4 70254803 missense probably benign
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0482:Cdk5rap2 UTSW 4 70410269 start gained probably benign
R0548:Cdk5rap2 UTSW 4 70349142 critical splice donor site probably null
R0594:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R0737:Cdk5rap2 UTSW 4 70337375 missense probably benign 0.01
R0788:Cdk5rap2 UTSW 4 70307231 missense possibly damaging 0.90
R0960:Cdk5rap2 UTSW 4 70243508 missense probably benign 0.03
R1682:Cdk5rap2 UTSW 4 70302150 missense possibly damaging 0.92
R1727:Cdk5rap2 UTSW 4 70272679 missense probably benign
R1727:Cdk5rap2 UTSW 4 70289972 missense possibly damaging 0.70
R1768:Cdk5rap2 UTSW 4 70307233 missense probably benign 0.09
R1903:Cdk5rap2 UTSW 4 70403554 splice site probably null
R2270:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2271:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2272:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2364:Cdk5rap2 UTSW 4 70360809 critical splice donor site probably null
R2763:Cdk5rap2 UTSW 4 70281271 missense probably benign
R2893:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2894:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2958:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2959:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2961:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2962:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2963:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3522:Cdk5rap2 UTSW 4 70250410 missense probably damaging 1.00
R3725:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3726:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3876:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3919:Cdk5rap2 UTSW 4 70380223 missense possibly damaging 0.50
R4025:Cdk5rap2 UTSW 4 70250387 missense probably damaging 0.98
R4324:Cdk5rap2 UTSW 4 70353614 missense probably damaging 1.00
R4485:Cdk5rap2 UTSW 4 70239283 critical splice donor site probably null
R4516:Cdk5rap2 UTSW 4 70276715 splice site probably null
R4556:Cdk5rap2 UTSW 4 70239312 missense probably damaging 0.97
R4560:Cdk5rap2 UTSW 4 70315331 missense probably benign 0.03
R4584:Cdk5rap2 UTSW 4 70266760 missense probably damaging 1.00
R4620:Cdk5rap2 UTSW 4 70266706 missense probably benign 0.00
R4639:Cdk5rap2 UTSW 4 70302176 missense probably damaging 0.97
R4755:Cdk5rap2 UTSW 4 70238425 missense probably damaging 1.00
R4947:Cdk5rap2 UTSW 4 70228592 splice site probably null
R5116:Cdk5rap2 UTSW 4 70307238 missense possibly damaging 0.67
R5449:Cdk5rap2 UTSW 4 70276651 missense probably benign 0.00
R5643:Cdk5rap2 UTSW 4 70266733 missense probably damaging 0.99
R5899:Cdk5rap2 UTSW 4 70243593 splice site probably benign
R6177:Cdk5rap2 UTSW 4 70281482 missense probably damaging 0.99
R6254:Cdk5rap2 UTSW 4 70364032 missense probably damaging 1.00
R6326:Cdk5rap2 UTSW 4 70235454 missense probably damaging 1.00
R6335:Cdk5rap2 UTSW 4 70266612 missense possibly damaging 0.79
R6534:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R6857:Cdk5rap2 UTSW 4 70245396 nonsense probably null
R6959:Cdk5rap2 UTSW 4 70360669 splice site probably null
R7104:Cdk5rap2 UTSW 4 70349156 missense probably benign 0.00
R7145:Cdk5rap2 UTSW 4 70238231 missense probably benign 0.13
R7223:Cdk5rap2 UTSW 4 70235447 missense probably benign 0.02
R7234:Cdk5rap2 UTSW 4 70376787 splice site probably null
R7240:Cdk5rap2 UTSW 4 70291908 missense probably damaging 1.00
R7247:Cdk5rap2 UTSW 4 70337429 missense probably damaging 1.00
R7382:Cdk5rap2 UTSW 4 70290025 missense probably benign 0.19
R7413:Cdk5rap2 UTSW 4 70254735 missense probably damaging 1.00
R7576:Cdk5rap2 UTSW 4 70266872 missense probably benign 0.01
R8236:Cdk5rap2 UTSW 4 70242485 missense probably benign
R8434:Cdk5rap2 UTSW 4 70364020 missense probably benign 0.00
R8688:Cdk5rap2 UTSW 4 70380273 missense probably damaging 1.00
R8706:Cdk5rap2 UTSW 4 70239325 missense probably benign 0.08
R8731:Cdk5rap2 UTSW 4 70245510 splice site probably benign
R8782:Cdk5rap2 UTSW 4 70243475 missense possibly damaging 0.57
R8855:Cdk5rap2 UTSW 4 70300650 missense probably damaging 1.00
R8965:Cdk5rap2 UTSW 4 70266805 missense probably benign 0.30
R9242:Cdk5rap2 UTSW 4 70337346 missense possibly damaging 0.46
R9308:Cdk5rap2 UTSW 4 70410267 start codon destroyed probably null 0.99
R9396:Cdk5rap2 UTSW 4 70254666 missense possibly damaging 0.75
R9507:Cdk5rap2 UTSW 4 70291873 missense probably benign
Z1176:Cdk5rap2 UTSW 4 70266743 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACCATGGAGAAACAGCCTCTC -3'
(R):5'- GCTGTTTGAACTCAAAGAAGGG -3'

Sequencing Primer
(F):5'- GAGAAACAGCCTCTCCAGTTG -3'
(R):5'- GCTTGTACAGCTACGGGC -3'
Posted On 2022-04-18