Incidental Mutation 'R9396:Stim1'
ID 710827
Institutional Source Beutler Lab
Gene Symbol Stim1
Ensembl Gene ENSMUSG00000030987
Gene Name stromal interaction molecule 1
Synonyms SIM
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9396 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 102267806-102437319 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 102415385 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 221 (V221I)
Ref Sequence ENSEMBL: ENSMUSP00000033289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]
AlphaFold P70302
Predicted Effect possibly damaging
Transcript: ENSMUST00000033289
AA Change: V221I

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987
AA Change: V221I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
SAM 129 200 5.51e-6 SMART
SCOP:d1eq1a_ 229 334 1e-2 SMART
PDB:4O9B|D 237 340 3e-59 PDB
Pfam:SOAR 341 441 1.4e-46 PFAM
low complexity region 485 499 N/A INTRINSIC
low complexity region 601 631 N/A INTRINSIC
low complexity region 672 685 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209255
AA Change: V221I

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000211457
AA Change: V221I

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T A 17: 84,692,854 F281I probably damaging Het
Acad8 A G 9: 26,975,745 M402T probably damaging Het
Apcdd1 C T 18: 62,922,660 probably benign Het
Apol7a T C 15: 77,389,725 E179G possibly damaging Het
Asmt A G X: 170,676,406 T217A probably benign Het
Cadm2 T C 16: 66,747,216 Y318C probably damaging Het
Cckar G A 5: 53,707,281 T26M probably damaging Het
Cd300ld G A 11: 114,987,404 T94I probably damaging Het
Cdk5rap2 A G 4: 70,254,666 Y1390H possibly damaging Het
Cdk5rap2 C T 4: 70,264,658 S1268N probably damaging Het
Csrnp3 C T 2: 66,002,497 R127C probably damaging Het
Dsc2 T A 18: 20,041,716 R501* probably null Het
Dusp2 C T 2: 127,337,718 R294C probably damaging Het
Edrf1 A G 7: 133,660,109 K878E possibly damaging Het
Evc T C 5: 37,319,090 T372A possibly damaging Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fcgr1 T A 3: 96,287,074 K166* probably null Het
Fstl4 C A 11: 52,773,951 P36Q probably benign Het
Gas2l2 A T 11: 83,422,833 I551N probably benign Het
Hc G T 2: 35,037,603 S333* probably null Het
Ibsp A G 5: 104,310,431 Y278C probably damaging Het
Ifitm10 A T 7: 142,370,967 V45D probably damaging Het
Kcnc3 T C 7: 44,591,513 S210P possibly damaging Het
Klhl3 T G 13: 58,013,848 T531P probably damaging Het
Mapt C A 11: 104,298,729 P191Q possibly damaging Het
Mpp5 G T 12: 78,824,747 R367L possibly damaging Het
Myh9 T C 15: 77,763,296 T1840A probably benign Het
Myof A T 19: 37,934,846 C1320S probably damaging Het
Myom3 G T 4: 135,785,888 V626L probably benign Het
Ndor1 A G 2: 25,248,909 L321P probably benign Het
Nhsl1 T A 10: 18,524,001 M291K probably damaging Het
Nubp2 C T 17: 24,884,502 V134I probably benign Het
Nuf2 T C 1: 169,510,348 I287V probably benign Het
Olfr1066 A T 2: 86,455,501 C257S probably benign Het
Olfr1290 A G 2: 111,489,519 L213P probably benign Het
Olfr134 T A 17: 38,175,530 W149R probably damaging Het
Olfr195 G A 16: 59,148,939 V30M probably damaging Het
Olfr412 T A 11: 74,365,263 M198K probably benign Het
Olfr544 A C 7: 102,484,973 V49G possibly damaging Het
Olfr641 A G 7: 104,040,513 N239S probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp1r12a A G 10: 108,264,710 E863G probably damaging Het
Pskh1 C T 8: 105,913,459 T257M possibly damaging Het
Rasgef1b T C 5: 99,229,329 I334V probably benign Het
Rnf180 T A 13: 105,181,519 K462* probably null Het
Sin3a A G 9: 57,101,161 D455G probably benign Het
Slc15a4 A G 5: 127,617,399 probably benign Het
Slc2a13 T C 15: 91,343,712 T426A probably benign Het
Smarca5 T C 8: 80,736,729 K70R probably benign Het
Smg1 A G 7: 118,208,080 V182A unknown Het
Tbx18 T C 9: 87,727,379 D201G probably damaging Het
Tcf25 A G 8: 123,401,092 E630G probably benign Het
Tm7sf3 T C 6: 146,621,974 N135S possibly damaging Het
Tmem28 C T X: 99,845,491 R321W probably damaging Het
Togaram1 A G 12: 64,967,655 N560S probably damaging Het
Unc13d A G 11: 116,075,703 probably null Het
Zfp445 A C 9: 122,852,516 S787A probably benign Het
Zfp949 T C 9: 88,567,207 W22R probably damaging Het
Other mutations in Stim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Stim1 APN 7 102426747 missense probably damaging 1.00
IGL01390:Stim1 APN 7 102427162 missense possibly damaging 0.73
IGL01602:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01605:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01697:Stim1 APN 7 102425969 splice site probably benign
IGL01826:Stim1 APN 7 102427075 splice site probably benign
IGL01908:Stim1 APN 7 102435650 missense probably benign
IGL02869:Stim1 APN 7 102268551 missense unknown
IGL03146:Stim1 APN 7 102421355 missense probably damaging 1.00
R0217:Stim1 UTSW 7 102435800 missense probably benign 0.00
R1320:Stim1 UTSW 7 102408406 missense possibly damaging 0.79
R1639:Stim1 UTSW 7 102354541 missense probably benign 0.31
R1643:Stim1 UTSW 7 102386100 missense possibly damaging 0.92
R1697:Stim1 UTSW 7 102354506 missense probably damaging 1.00
R2424:Stim1 UTSW 7 102408405 missense probably benign 0.03
R3838:Stim1 UTSW 7 102411296 missense possibly damaging 0.71
R3940:Stim1 UTSW 7 102435641 missense probably benign 0.00
R4820:Stim1 UTSW 7 102415364 missense probably damaging 0.97
R4871:Stim1 UTSW 7 102354572 missense probably damaging 1.00
R5110:Stim1 UTSW 7 102268422 missense unknown
R5787:Stim1 UTSW 7 102435440 missense possibly damaging 0.52
R6400:Stim1 UTSW 7 102430950 missense probably null 0.99
R6788:Stim1 UTSW 7 102427291 missense probably damaging 0.99
R7112:Stim1 UTSW 7 102408408 missense probably benign 0.01
R7125:Stim1 UTSW 7 102435534 missense possibly damaging 0.69
R7247:Stim1 UTSW 7 102421532 critical splice donor site probably null
R7650:Stim1 UTSW 7 102428827 missense
R7807:Stim1 UTSW 7 102427141 missense probably damaging 0.99
R8304:Stim1 UTSW 7 102435481 missense possibly damaging 0.55
R8462:Stim1 UTSW 7 102427117 missense probably damaging 1.00
R8528:Stim1 UTSW 7 102431082 intron probably benign
R8883:Stim1 UTSW 7 102431050 missense unknown
R8921:Stim1 UTSW 7 102421390 missense probably damaging 0.99
R8924:Stim1 UTSW 7 102428807 missense
R9018:Stim1 UTSW 7 102411275 missense probably benign 0.05
R9164:Stim1 UTSW 7 102435419 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GCAGTTCCTTCTAAGTTGAAAGGTC -3'
(R):5'- GAGACTTCTAAGAGCTGGTAGTACC -3'

Sequencing Primer
(F):5'- GGTCTGCCTTTTACAAGAGGAATCAC -3'
(R):5'- CCTGATCTACAAAGTGAGTTCCAGG -3'
Posted On 2022-04-18