Incidental Mutation 'R9396:Apcdd1'
ID 710863
Institutional Source Beutler Lab
Gene Symbol Apcdd1
Ensembl Gene ENSMUSG00000071847
Gene Name adenomatosis polyposis coli down-regulated 1
Synonyms Drapc1, EIG180
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock # R9396 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 62922327-62953195 bp(+) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) C to T at 62922660 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]
AlphaFold Q3U128
Predicted Effect probably benign
Transcript: ENSMUST00000096554
SMART Domains Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163716
SMART Domains Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T A 17: 84,692,854 F281I probably damaging Het
Acad8 A G 9: 26,975,745 M402T probably damaging Het
Apol7a T C 15: 77,389,725 E179G possibly damaging Het
Asmt A G X: 170,676,406 T217A probably benign Het
Cadm2 T C 16: 66,747,216 Y318C probably damaging Het
Cckar G A 5: 53,707,281 T26M probably damaging Het
Cd300ld G A 11: 114,987,404 T94I probably damaging Het
Cdk5rap2 A G 4: 70,254,666 Y1390H possibly damaging Het
Cdk5rap2 C T 4: 70,264,658 S1268N probably damaging Het
Csrnp3 C T 2: 66,002,497 R127C probably damaging Het
Dsc2 T A 18: 20,041,716 R501* probably null Het
Dusp2 C T 2: 127,337,718 R294C probably damaging Het
Edrf1 A G 7: 133,660,109 K878E possibly damaging Het
Evc T C 5: 37,319,090 T372A possibly damaging Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fcgr1 T A 3: 96,287,074 K166* probably null Het
Fstl4 C A 11: 52,773,951 P36Q probably benign Het
Gas2l2 A T 11: 83,422,833 I551N probably benign Het
Hc G T 2: 35,037,603 S333* probably null Het
Ibsp A G 5: 104,310,431 Y278C probably damaging Het
Ifitm10 A T 7: 142,370,967 V45D probably damaging Het
Kcnc3 T C 7: 44,591,513 S210P possibly damaging Het
Klhl3 T G 13: 58,013,848 T531P probably damaging Het
Mapt C A 11: 104,298,729 P191Q possibly damaging Het
Mpp5 G T 12: 78,824,747 R367L possibly damaging Het
Myh9 T C 15: 77,763,296 T1840A probably benign Het
Myof A T 19: 37,934,846 C1320S probably damaging Het
Myom3 G T 4: 135,785,888 V626L probably benign Het
Ndor1 A G 2: 25,248,909 L321P probably benign Het
Nhsl1 T A 10: 18,524,001 M291K probably damaging Het
Nubp2 C T 17: 24,884,502 V134I probably benign Het
Nuf2 T C 1: 169,510,348 I287V probably benign Het
Olfr1066 A T 2: 86,455,501 C257S probably benign Het
Olfr1290 A G 2: 111,489,519 L213P probably benign Het
Olfr134 T A 17: 38,175,530 W149R probably damaging Het
Olfr195 G A 16: 59,148,939 V30M probably damaging Het
Olfr412 T A 11: 74,365,263 M198K probably benign Het
Olfr544 A C 7: 102,484,973 V49G possibly damaging Het
Olfr641 A G 7: 104,040,513 N239S probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp1r12a A G 10: 108,264,710 E863G probably damaging Het
Pskh1 C T 8: 105,913,459 T257M possibly damaging Het
Rasgef1b T C 5: 99,229,329 I334V probably benign Het
Rnf180 T A 13: 105,181,519 K462* probably null Het
Sin3a A G 9: 57,101,161 D455G probably benign Het
Slc15a4 A G 5: 127,617,399 probably benign Het
Slc2a13 T C 15: 91,343,712 T426A probably benign Het
Smarca5 T C 8: 80,736,729 K70R probably benign Het
Smg1 A G 7: 118,208,080 V182A unknown Het
Stim1 G A 7: 102,415,385 V221I possibly damaging Het
Tbx18 T C 9: 87,727,379 D201G probably damaging Het
Tcf25 A G 8: 123,401,092 E630G probably benign Het
Tm7sf3 T C 6: 146,621,974 N135S possibly damaging Het
Tmem28 C T X: 99,845,491 R321W probably damaging Het
Togaram1 A G 12: 64,967,655 N560S probably damaging Het
Unc13d A G 11: 116,075,703 probably null Het
Zfp445 A C 9: 122,852,516 S787A probably benign Het
Zfp949 T C 9: 88,567,207 W22R probably damaging Het
Other mutations in Apcdd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Apcdd1 APN 18 62933865 splice site probably benign
IGL01522:Apcdd1 APN 18 62952115 missense possibly damaging 0.50
IGL01637:Apcdd1 APN 18 62937286 missense probably damaging 1.00
IGL02069:Apcdd1 APN 18 62949983 missense probably damaging 1.00
IGL02183:Apcdd1 APN 18 62951854 missense probably damaging 0.98
IGL02268:Apcdd1 APN 18 62950188 missense probably damaging 0.99
IGL02664:Apcdd1 APN 18 62951820 splice site probably benign
R0207:Apcdd1 UTSW 18 62950079 missense probably benign 0.04
R0363:Apcdd1 UTSW 18 62937097 missense possibly damaging 0.46
R0540:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0567:Apcdd1 UTSW 18 62934036 missense possibly damaging 0.93
R0607:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0629:Apcdd1 UTSW 18 62933970 missense probably damaging 1.00
R1118:Apcdd1 UTSW 18 62952024 missense probably benign
R1178:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1180:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1181:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R4363:Apcdd1 UTSW 18 62951932 missense possibly damaging 0.95
R5534:Apcdd1 UTSW 18 62937034 missense probably benign 0.01
R5622:Apcdd1 UTSW 18 62936902 splice site probably null
R5771:Apcdd1 UTSW 18 62936956 missense probably damaging 1.00
R5852:Apcdd1 UTSW 18 62937063 missense probably damaging 1.00
R5934:Apcdd1 UTSW 18 62951869 missense possibly damaging 0.72
R6109:Apcdd1 UTSW 18 62937366 missense probably damaging 1.00
R6515:Apcdd1 UTSW 18 62951839 missense probably damaging 1.00
R6625:Apcdd1 UTSW 18 62951858 missense probably damaging 1.00
R6831:Apcdd1 UTSW 18 62950126 nonsense probably null
R6931:Apcdd1 UTSW 18 62933908 missense probably damaging 1.00
R7018:Apcdd1 UTSW 18 62937049 missense probably damaging 0.98
R7115:Apcdd1 UTSW 18 62936953 missense probably damaging 1.00
R7148:Apcdd1 UTSW 18 62951845 missense probably damaging 1.00
R7326:Apcdd1 UTSW 18 62952188 nonsense probably null
R8025:Apcdd1 UTSW 18 62936908 missense probably damaging 1.00
R8114:Apcdd1 UTSW 18 62950056 missense probably damaging 1.00
R8261:Apcdd1 UTSW 18 62933903 missense possibly damaging 0.86
R8404:Apcdd1 UTSW 18 62933915 missense possibly damaging 0.66
R9015:Apcdd1 UTSW 18 62950086 missense possibly damaging 0.93
R9040:Apcdd1 UTSW 18 62937343 missense probably damaging 0.96
R9288:Apcdd1 UTSW 18 62922660 start gained probably benign
R9295:Apcdd1 UTSW 18 62922660 start gained probably benign
R9297:Apcdd1 UTSW 18 62922660 start gained probably benign
R9317:Apcdd1 UTSW 18 62922660 start gained probably benign
R9319:Apcdd1 UTSW 18 62922660 start gained probably benign
R9393:Apcdd1 UTSW 18 62922660 start gained probably benign
R9394:Apcdd1 UTSW 18 62922660 start gained probably benign
R9397:Apcdd1 UTSW 18 62922660 start gained probably benign
X0028:Apcdd1 UTSW 18 62937130 missense possibly damaging 0.59
Z1088:Apcdd1 UTSW 18 62937183 missense probably benign 0.18
Z1177:Apcdd1 UTSW 18 62922691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTACCTCTGAGCTGTGCAC -3'
(R):5'- GTTCGCATCCTTCCAGAAAGAAC -3'

Sequencing Primer
(F):5'- GCTGCGGTTCGGAGTCC -3'
(R):5'- AAAACCACTGCGGGTGC -3'
Posted On 2022-04-18