Incidental Mutation 'R9397:Polr3b'
ID 710890
Institutional Source Beutler Lab
Gene Symbol Polr3b
Ensembl Gene ENSMUSG00000034453
Gene Name polymerase (RNA) III (DNA directed) polypeptide B
Synonyms RPC2, A330032P03Rik, 2700078H01Rik
Accession Numbers

Genbank: NM_027423

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9397 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 84622292-84727178 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 84631789 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 78 (L78F)
Ref Sequence ENSEMBL: ENSMUSP00000076418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077175]
AlphaFold P59470
Predicted Effect possibly damaging
Transcript: ENSMUST00000077175
AA Change: L78F

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076418
Gene: ENSMUSG00000034453
AA Change: L78F

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 38 413 2e-55 PFAM
Pfam:RNA_pol_Rpb2_2 185 363 8.4e-29 PFAM
Pfam:RNA_pol_Rpb2_3 438 502 2.6e-22 PFAM
Pfam:RNA_pol_Rpb2_4 539 600 1e-29 PFAM
Pfam:RNA_pol_Rpb2_5 621 661 6.5e-14 PFAM
Pfam:RNA_pol_Rpb2_6 668 1041 5.8e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1043 1129 7.6e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase III, the polymerase responsible for synthesizing transfer and small ribosomal RNAs in eukaryotes. The largest subunit and the encoded protein form the catalytic center of RNA polymerase III. Mutations in this gene are a cause of hypomyelinating leukodystrophy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(48) : Targeted, other(2) Gene trapped(46)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930555G01Rik T G 14: 5,051,639 V66G possibly damaging Het
A630001G21Rik G T 1: 85,725,281 Y55* probably null Het
Abca8a G A 11: 110,030,347 T1474I probably damaging Het
Acaca T G 11: 84,368,725 I1962S probably damaging Het
Acap1 A T 11: 69,884,846 S455T probably damaging Het
Acbd7 G A 2: 3,336,222 probably null Het
Adamts9 A G 6: 92,901,463 L541P probably damaging Het
Ankrd49 T C 9: 14,781,415 N151S probably benign Het
Apcdd1 C T 18: 62,922,660 probably benign Het
Arhgap27 T C 11: 103,340,289 D58G probably damaging Het
BC003331 C T 1: 150,362,865 A434T probably damaging Het
Btbd18 G T 2: 84,667,466 A483S probably damaging Het
C2 A G 17: 34,875,989 S257P probably damaging Het
Catsper3 T A 13: 55,798,912 Y141N probably damaging Het
Cfap54 G A 10: 92,997,285 L1160F probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Cyp4f14 C T 17: 32,911,542 G141D probably damaging Het
Duox1 C T 2: 122,320,302 T286I possibly damaging Het
Epc2 G A 2: 49,488,810 G92E probably damaging Het
Fmnl3 C T 15: 99,328,057 probably null Het
Glyatl3 G A 17: 40,912,674 R59* probably null Het
Gm3633 T A 14: 42,638,443 Q181L Het
Guca1b C T 17: 47,385,635 T49M probably benign Het
Hdac9 T A 12: 34,303,276 H645L probably damaging Het
Hhip T C 8: 79,992,483 R472G probably benign Het
Ifi203 A G 1: 173,937,981 V9A probably damaging Het
Igkv9-123 A T 6: 67,954,459 V41D probably damaging Het
Il5ra T A 6: 106,744,297 T14S probably benign Het
Ints2 A G 11: 86,244,485 S368P probably benign Het
Kat6b T A 14: 21,625,176 S470T possibly damaging Het
Kmt2d A G 15: 98,850,113 V3110A unknown Het
Lama2 T C 10: 27,105,121 N1846D probably benign Het
Lrp1b T A 2: 40,750,910 E3507D Het
Ly6g6c A G 17: 35,069,341 N63S probably benign Het
Naprt C T 15: 75,892,010 V354I probably null Het
Nars A G 18: 64,509,256 S172P probably benign Het
Olfr785 A G 10: 129,410,040 R225G possibly damaging Het
Olfr873 T C 9: 20,300,452 I85T possibly damaging Het
Pcdhb6 A G 18: 37,336,300 D758G probably benign Het
Pkp4 G A 2: 59,318,512 W536* probably null Het
Rasa4 T A 5: 136,100,982 V272E possibly damaging Het
Syne2 A G 12: 75,994,075 T3836A possibly damaging Het
Tbpl2 C T 2: 24,076,058 V308I possibly damaging Het
Tcea1 T A 1: 4,891,918 I176K probably damaging Het
Try5 A T 6: 41,312,380 F87L probably benign Het
Ttc8 G T 12: 98,976,433 G411* probably null Het
Vmn2r115 G A 17: 23,345,178 W108* probably null Het
Zdhhc13 C T 7: 48,826,880 T581I probably benign Het
Zfp777 G T 6: 48,044,256 T144K probably benign Het
Other mutations in Polr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Polr3b APN 10 84676990 missense probably benign
IGL00848:Polr3b APN 10 84680377 missense probably damaging 1.00
IGL00901:Polr3b APN 10 84631796 missense possibly damaging 0.94
IGL01313:Polr3b APN 10 84725743 missense probably damaging 1.00
IGL01364:Polr3b APN 10 84695669 missense probably benign 0.00
IGL01731:Polr3b APN 10 84631840 nonsense probably null
IGL03326:Polr3b APN 10 84667395 missense probably benign 0.43
IGL03369:Polr3b APN 10 84676952 missense probably damaging 1.00
etruscan UTSW 10 84632538 missense probably benign 0.00
pennyweight UTSW 10 84713632 missense probably damaging 1.00
pinhead UTSW 10 84655991 missense probably damaging 1.00
G5538:Polr3b UTSW 10 84631794 missense probably benign 0.21
PIT4382001:Polr3b UTSW 10 84684185 missense probably damaging 1.00
R0180:Polr3b UTSW 10 84622515 missense probably benign
R0270:Polr3b UTSW 10 84718475 missense probably benign 0.02
R0541:Polr3b UTSW 10 84638064 missense probably damaging 1.00
R0890:Polr3b UTSW 10 84714336 missense probably benign 0.01
R1302:Polr3b UTSW 10 84632486 missense probably damaging 0.97
R1511:Polr3b UTSW 10 84680385 missense probably benign
R1561:Polr3b UTSW 10 84634912 missense probably damaging 1.00
R1607:Polr3b UTSW 10 84652783 missense probably benign 0.00
R1624:Polr3b UTSW 10 84679805 missense probably damaging 0.98
R1809:Polr3b UTSW 10 84693001 missense probably damaging 1.00
R1830:Polr3b UTSW 10 84692922 nonsense probably null
R2973:Polr3b UTSW 10 84628280 missense probably benign 0.00
R3401:Polr3b UTSW 10 84699491 missense probably damaging 0.96
R3876:Polr3b UTSW 10 84720518 critical splice donor site probably null
R3961:Polr3b UTSW 10 84684302 missense possibly damaging 0.89
R4664:Polr3b UTSW 10 84714369 missense probably damaging 1.00
R4721:Polr3b UTSW 10 84656003 missense possibly damaging 0.56
R4972:Polr3b UTSW 10 84638124 missense probably damaging 1.00
R5065:Polr3b UTSW 10 84632538 missense probably benign 0.00
R5264:Polr3b UTSW 10 84667416 missense probably benign 0.02
R5302:Polr3b UTSW 10 84699400 missense possibly damaging 0.59
R5795:Polr3b UTSW 10 84628252 missense probably benign
R5795:Polr3b UTSW 10 84677011 missense probably damaging 0.97
R5838:Polr3b UTSW 10 84674590 missense probably benign 0.09
R6419:Polr3b UTSW 10 84638111 missense possibly damaging 0.78
R6568:Polr3b UTSW 10 84634903 missense probably damaging 1.00
R6787:Polr3b UTSW 10 84628625 critical splice acceptor site probably null
R6913:Polr3b UTSW 10 84713632 missense probably damaging 1.00
R7405:Polr3b UTSW 10 84684179 missense probably benign
R7456:Polr3b UTSW 10 84622491 missense probably benign
R7657:Polr3b UTSW 10 84655991 missense probably damaging 1.00
R8074:Polr3b UTSW 10 84713659 missense probably damaging 1.00
R8082:Polr3b UTSW 10 84656063 missense probably damaging 1.00
R8127:Polr3b UTSW 10 84679789 missense probably benign
R8676:Polr3b UTSW 10 84680387 missense probably benign 0.00
R8744:Polr3b UTSW 10 84628624 splice site probably benign
R8797:Polr3b UTSW 10 84697015 nonsense probably null
R8866:Polr3b UTSW 10 84695691 missense probably benign 0.14
R9006:Polr3b UTSW 10 84631833 missense probably benign 0.05
X0066:Polr3b UTSW 10 84713695 missense probably damaging 0.97
Z1177:Polr3b UTSW 10 84714293 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCATCCCACACTTGTAAGGTTC -3'
(R):5'- CAACAGGGTCTGAGATTTTCAAG -3'

Sequencing Primer
(F):5'- CCCACACTTGTAAGGTTCTATGAAC -3'
(R):5'- GAAAAGTACCTCATGAGGG -3'
Posted On 2022-04-18