Mutagenetix > Incidental Mutations

Incidental Mutation 'R9397:Polr3b'

710890

Institutional Source

Beutler Lab

Gene Symbol

Polr3b

Ensembl Gene

ENSMUSG00000034453

Gene Name

polymerase (RNA) III (DNA directed) polypeptide B

Synonyms

RPC2, A330032P03Rik, 2700078H01Rik

Accession Numbers

Genbank: NM_027423

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9397 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84622292-84727178 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 84631789 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 78 (L78F)

Ref Sequence

ENSEMBL: ENSMUSP00000076418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077175]

AlphaFold

P59470

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077175
AA Change: L78F

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000076418
Gene: ENSMUSG00000034453
AA Change: L78F

Domain	Start	End	E-Value	Type
Pfam:RNA_pol_Rpb2_1	38	413	2e-55	PFAM
Pfam:RNA_pol_Rpb2_2	185	363	8.4e-29	PFAM
Pfam:RNA_pol_Rpb2_3	438	502	2.6e-22	PFAM
Pfam:RNA_pol_Rpb2_4	539	600	1e-29	PFAM
Pfam:RNA_pol_Rpb2_5	621	661	6.5e-14	PFAM
Pfam:RNA_pol_Rpb2_6	668	1041	5.8e-129	PFAM
Pfam:RNA_pol_Rpb2_7	1043	1129	7.6e-36	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase III, the polymerase responsible for synthesizing transfer and small ribosomal RNAs in eukaryotes. The largest subunit and the encoded protein form the catalytic center of RNA polymerase III. Mutations in this gene are a cause of hypomyelinating leukodystrophy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]

Allele List at MGI

All alleles(48) : Targeted, other(2) Gene trapped(46)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930555G01Rik	T	G	14: 5,051,639	V66G	possibly damaging	Het
A630001G21Rik	G	T	1: 85,725,281	Y55*	probably null	Het
Abca8a	G	A	11: 110,030,347	T1474I	probably damaging	Het
Acaca	T	G	11: 84,368,725	I1962S	probably damaging	Het
Acap1	A	T	11: 69,884,846	S455T	probably damaging	Het
Acbd7	G	A	2: 3,336,222		probably null	Het
Adamts9	A	G	6: 92,901,463	L541P	probably damaging	Het
Ankrd49	T	C	9: 14,781,415	N151S	probably benign	Het
Apcdd1	C	T	18: 62,922,660		probably benign	Het
Arhgap27	T	C	11: 103,340,289	D58G	probably damaging	Het
BC003331	C	T	1: 150,362,865	A434T	probably damaging	Het
Btbd18	G	T	2: 84,667,466	A483S	probably damaging	Het
C2	A	G	17: 34,875,989	S257P	probably damaging	Het
Catsper3	T	A	13: 55,798,912	Y141N	probably damaging	Het
Cfap54	G	A	10: 92,997,285	L1160F	probably damaging	Het
Chst13	G	A	6: 90,309,524	P152L	probably damaging	Het
Cyp4f14	C	T	17: 32,911,542	G141D	probably damaging	Het
Duox1	C	T	2: 122,320,302	T286I	possibly damaging	Het
Epc2	G	A	2: 49,488,810	G92E	probably damaging	Het
Fmnl3	C	T	15: 99,328,057		probably null	Het
Glyatl3	G	A	17: 40,912,674	R59*	probably null	Het
Gm3633	T	A	14: 42,638,443	Q181L		Het
Guca1b	C	T	17: 47,385,635	T49M	probably benign	Het
Hdac9	T	A	12: 34,303,276	H645L	probably damaging	Het
Hhip	T	C	8: 79,992,483	R472G	probably benign	Het
Ifi203	A	G	1: 173,937,981	V9A	probably damaging	Het
Igkv9-123	A	T	6: 67,954,459	V41D	probably damaging	Het
Il5ra	T	A	6: 106,744,297	T14S	probably benign	Het
Ints2	A	G	11: 86,244,485	S368P	probably benign	Het
Kat6b	T	A	14: 21,625,176	S470T	possibly damaging	Het
Kmt2d	A	G	15: 98,850,113	V3110A	unknown	Het
Lama2	T	C	10: 27,105,121	N1846D	probably benign	Het
Lrp1b	T	A	2: 40,750,910	E3507D		Het
Ly6g6c	A	G	17: 35,069,341	N63S	probably benign	Het
Naprt	C	T	15: 75,892,010	V354I	probably null	Het
Nars	A	G	18: 64,509,256	S172P	probably benign	Het
Olfr785	A	G	10: 129,410,040	R225G	possibly damaging	Het
Olfr873	T	C	9: 20,300,452	I85T	possibly damaging	Het
Pcdhb6	A	G	18: 37,336,300	D758G	probably benign	Het
Pkp4	G	A	2: 59,318,512	W536*	probably null	Het
Rasa4	T	A	5: 136,100,982	V272E	possibly damaging	Het
Syne2	A	G	12: 75,994,075	T3836A	possibly damaging	Het
Tbpl2	C	T	2: 24,076,058	V308I	possibly damaging	Het
Tcea1	T	A	1: 4,891,918	I176K	probably damaging	Het
Try5	A	T	6: 41,312,380	F87L	probably benign	Het
Ttc8	G	T	12: 98,976,433	G411*	probably null	Het
Vmn2r115	G	A	17: 23,345,178	W108*	probably null	Het
Zdhhc13	C	T	7: 48,826,880	T581I	probably benign	Het
Zfp777	G	T	6: 48,044,256	T144K	probably benign	Het

Other mutations in Polr3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00787:Polr3b	APN	10	84676990	missense	probably benign
IGL00848:Polr3b	APN	10	84680377	missense	probably damaging	1.00
IGL00901:Polr3b	APN	10	84631796	missense	possibly damaging	0.94
IGL01313:Polr3b	APN	10	84725743	missense	probably damaging	1.00
IGL01364:Polr3b	APN	10	84695669	missense	probably benign	0.00
IGL01731:Polr3b	APN	10	84631840	nonsense	probably null
IGL03326:Polr3b	APN	10	84667395	missense	probably benign	0.43
IGL03369:Polr3b	APN	10	84676952	missense	probably damaging	1.00
etruscan	UTSW	10	84632538	missense	probably benign	0.00
pennyweight	UTSW	10	84713632	missense	probably damaging	1.00
pinhead	UTSW	10	84655991	missense	probably damaging	1.00
G5538:Polr3b	UTSW	10	84631794	missense	probably benign	0.21
PIT4382001:Polr3b	UTSW	10	84684185	missense	probably damaging	1.00
R0180:Polr3b	UTSW	10	84622515	missense	probably benign
R0270:Polr3b	UTSW	10	84718475	missense	probably benign	0.02
R0541:Polr3b	UTSW	10	84638064	missense	probably damaging	1.00
R0890:Polr3b	UTSW	10	84714336	missense	probably benign	0.01
R1302:Polr3b	UTSW	10	84632486	missense	probably damaging	0.97
R1511:Polr3b	UTSW	10	84680385	missense	probably benign
R1561:Polr3b	UTSW	10	84634912	missense	probably damaging	1.00
R1607:Polr3b	UTSW	10	84652783	missense	probably benign	0.00
R1624:Polr3b	UTSW	10	84679805	missense	probably damaging	0.98
R1809:Polr3b	UTSW	10	84693001	missense	probably damaging	1.00
R1830:Polr3b	UTSW	10	84692922	nonsense	probably null
R2973:Polr3b	UTSW	10	84628280	missense	probably benign	0.00
R3401:Polr3b	UTSW	10	84699491	missense	probably damaging	0.96
R3876:Polr3b	UTSW	10	84720518	critical splice donor site	probably null
R3961:Polr3b	UTSW	10	84684302	missense	possibly damaging	0.89
R4664:Polr3b	UTSW	10	84714369	missense	probably damaging	1.00
R4721:Polr3b	UTSW	10	84656003	missense	possibly damaging	0.56
R4972:Polr3b	UTSW	10	84638124	missense	probably damaging	1.00
R5065:Polr3b	UTSW	10	84632538	missense	probably benign	0.00
R5264:Polr3b	UTSW	10	84667416	missense	probably benign	0.02
R5302:Polr3b	UTSW	10	84699400	missense	possibly damaging	0.59
R5795:Polr3b	UTSW	10	84628252	missense	probably benign
R5795:Polr3b	UTSW	10	84677011	missense	probably damaging	0.97
R5838:Polr3b	UTSW	10	84674590	missense	probably benign	0.09
R6419:Polr3b	UTSW	10	84638111	missense	possibly damaging	0.78
R6568:Polr3b	UTSW	10	84634903	missense	probably damaging	1.00
R6787:Polr3b	UTSW	10	84628625	critical splice acceptor site	probably null
R6913:Polr3b	UTSW	10	84713632	missense	probably damaging	1.00
R7405:Polr3b	UTSW	10	84684179	missense	probably benign
R7456:Polr3b	UTSW	10	84622491	missense	probably benign
R7657:Polr3b	UTSW	10	84655991	missense	probably damaging	1.00
R8074:Polr3b	UTSW	10	84713659	missense	probably damaging	1.00
R8082:Polr3b	UTSW	10	84656063	missense	probably damaging	1.00
R8127:Polr3b	UTSW	10	84679789	missense	probably benign
R8676:Polr3b	UTSW	10	84680387	missense	probably benign	0.00
R8744:Polr3b	UTSW	10	84628624	splice site	probably benign
R8797:Polr3b	UTSW	10	84697015	nonsense	probably null
R8866:Polr3b	UTSW	10	84695691	missense	probably benign	0.14
R9006:Polr3b	UTSW	10	84631833	missense	probably benign	0.05
X0066:Polr3b	UTSW	10	84713695	missense	probably damaging	0.97
Z1177:Polr3b	UTSW	10	84714293	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATCATCCCACACTTGTAAGGTTC -3'
(R):5'- CAACAGGGTCTGAGATTTTCAAG -3'

Sequencing Primer
(F):5'- CCCACACTTGTAAGGTTCTATGAAC -3'
(R):5'- GAAAAGTACCTCATGAGGG -3'

Posted On

2022-04-18