Mutagenetix > Incidental Mutation

Incidental Mutation 'R9397:Ints2'

710895

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9397 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86244485 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 368 (S368P)

Ref Sequence

ENSEMBL: ENSMUSP00000018212 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]

AlphaFold

Q80UK8

Predicted Effect

probably benign
Transcript: ENSMUST00000018212
AA Change: S368P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: S368P

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108039
AA Change: S368P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: S368P

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930555G01Rik	T	G	14: 5,051,639	V66G	possibly damaging	Het
A630001G21Rik	G	T	1: 85,725,281	Y55*	probably null	Het
Abca8a	G	A	11: 110,030,347	T1474I	probably damaging	Het
Acaca	T	G	11: 84,368,725	I1962S	probably damaging	Het
Acap1	A	T	11: 69,884,846	S455T	probably damaging	Het
Acbd7	G	A	2: 3,336,222		probably null	Het
Adamts9	A	G	6: 92,901,463	L541P	probably damaging	Het
Ankrd49	T	C	9: 14,781,415	N151S	probably benign	Het
Apcdd1	C	T	18: 62,922,660		probably benign	Het
Arhgap27	T	C	11: 103,340,289	D58G	probably damaging	Het
BC003331	C	T	1: 150,362,865	A434T	probably damaging	Het
Btbd18	G	T	2: 84,667,466	A483S	probably damaging	Het
C2	A	G	17: 34,875,989	S257P	probably damaging	Het
Catsper3	T	A	13: 55,798,912	Y141N	probably damaging	Het
Cfap54	G	A	10: 92,997,285	L1160F	probably damaging	Het
Chst13	G	A	6: 90,309,524	P152L	probably damaging	Het
Cyp4f14	C	T	17: 32,911,542	G141D	probably damaging	Het
Duox1	C	T	2: 122,320,302	T286I	possibly damaging	Het
Epc2	G	A	2: 49,488,810	G92E	probably damaging	Het
Fmnl3	C	T	15: 99,328,057		probably null	Het
Glyatl3	G	A	17: 40,912,674	R59*	probably null	Het
Gm3633	T	A	14: 42,638,443	Q181L		Het
Guca1b	C	T	17: 47,385,635	T49M	probably benign	Het
Hdac9	T	A	12: 34,303,276	H645L	probably damaging	Het
Hhip	T	C	8: 79,992,483	R472G	probably benign	Het
Ifi203	A	G	1: 173,937,981	V9A	probably damaging	Het
Igkv9-123	A	T	6: 67,954,459	V41D	probably damaging	Het
Il5ra	T	A	6: 106,744,297	T14S	probably benign	Het
Kat6b	T	A	14: 21,625,176	S470T	possibly damaging	Het
Kmt2d	A	G	15: 98,850,113	V3110A	unknown	Het
Lama2	T	C	10: 27,105,121	N1846D	probably benign	Het
Lrp1b	T	A	2: 40,750,910	E3507D		Het
Ly6g6c	A	G	17: 35,069,341	N63S	probably benign	Het
Naprt	C	T	15: 75,892,010	V354I	probably null	Het
Nars	A	G	18: 64,509,256	S172P	probably benign	Het
Olfr785	A	G	10: 129,410,040	R225G	possibly damaging	Het
Olfr873	T	C	9: 20,300,452	I85T	possibly damaging	Het
Pcdhb6	A	G	18: 37,336,300	D758G	probably benign	Het
Pkp4	G	A	2: 59,318,512	W536*	probably null	Het
Polr3b	C	T	10: 84,631,789	L78F	possibly damaging	Het
Rasa4	T	A	5: 136,100,982	V272E	possibly damaging	Het
Syne2	A	G	12: 75,994,075	T3836A	possibly damaging	Het
Tbpl2	C	T	2: 24,076,058	V308I	possibly damaging	Het
Tcea1	T	A	1: 4,891,918	I176K	probably damaging	Het
Try5	A	T	6: 41,312,380	F87L	probably benign	Het
Ttc8	G	T	12: 98,976,433	G411*	probably null	Het
Vmn2r115	G	A	17: 23,345,178	W108*	probably null	Het
Zdhhc13	C	T	7: 48,826,880	T581I	probably benign	Het
Zfp777	G	T	6: 48,044,256	T144K	probably benign	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null
R8942:Ints2	UTSW	11	86212894	missense	probably benign	0.00
R9037:Ints2	UTSW	11	86215704	missense	probably benign
R9154:Ints2	UTSW	11	86234698	missense	probably damaging	1.00
R9412:Ints2	UTSW	11	86226763	missense	probably damaging	0.99
R9472:Ints2	UTSW	11	86242998	missense
R9476:Ints2	UTSW	11	86244509	missense	probably benign
R9510:Ints2	UTSW	11	86244509	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGACCTGAACCCTCTTAATAAAGG -3'
(R):5'- GTGACAAGATCCATTCAGCTTCC -3'

Sequencing Primer
(F):5'- GAACCCTCTTAATAAAGGCCTTTGG -3'
(R):5'- TTAATGCAGTAACCGCTCCATG -3'

Posted On

2022-04-18