Incidental Mutation 'R9397:Apcdd1'
ID 710915
Institutional Source Beutler Lab
Gene Symbol Apcdd1
Ensembl Gene ENSMUSG00000071847
Gene Name adenomatosis polyposis coli down-regulated 1
Synonyms Drapc1, EIG180
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock # R9397 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 62922327-62953195 bp(+) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) C to T at 62922660 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]
AlphaFold Q3U128
Predicted Effect probably benign
Transcript: ENSMUST00000096554
SMART Domains Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163716
SMART Domains Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930555G01Rik T G 14: 5,051,639 V66G possibly damaging Het
A630001G21Rik G T 1: 85,725,281 Y55* probably null Het
Abca8a G A 11: 110,030,347 T1474I probably damaging Het
Acaca T G 11: 84,368,725 I1962S probably damaging Het
Acap1 A T 11: 69,884,846 S455T probably damaging Het
Acbd7 G A 2: 3,336,222 probably null Het
Adamts9 A G 6: 92,901,463 L541P probably damaging Het
Ankrd49 T C 9: 14,781,415 N151S probably benign Het
Arhgap27 T C 11: 103,340,289 D58G probably damaging Het
BC003331 C T 1: 150,362,865 A434T probably damaging Het
Btbd18 G T 2: 84,667,466 A483S probably damaging Het
C2 A G 17: 34,875,989 S257P probably damaging Het
Catsper3 T A 13: 55,798,912 Y141N probably damaging Het
Cfap54 G A 10: 92,997,285 L1160F probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Cyp4f14 C T 17: 32,911,542 G141D probably damaging Het
Duox1 C T 2: 122,320,302 T286I possibly damaging Het
Epc2 G A 2: 49,488,810 G92E probably damaging Het
Fmnl3 C T 15: 99,328,057 probably null Het
Glyatl3 G A 17: 40,912,674 R59* probably null Het
Gm3633 T A 14: 42,638,443 Q181L Het
Guca1b C T 17: 47,385,635 T49M probably benign Het
Hdac9 T A 12: 34,303,276 H645L probably damaging Het
Hhip T C 8: 79,992,483 R472G probably benign Het
Ifi203 A G 1: 173,937,981 V9A probably damaging Het
Igkv9-123 A T 6: 67,954,459 V41D probably damaging Het
Il5ra T A 6: 106,744,297 T14S probably benign Het
Ints2 A G 11: 86,244,485 S368P probably benign Het
Kat6b T A 14: 21,625,176 S470T possibly damaging Het
Kmt2d A G 15: 98,850,113 V3110A unknown Het
Lama2 T C 10: 27,105,121 N1846D probably benign Het
Lrp1b T A 2: 40,750,910 E3507D Het
Ly6g6c A G 17: 35,069,341 N63S probably benign Het
Naprt C T 15: 75,892,010 V354I probably null Het
Nars A G 18: 64,509,256 S172P probably benign Het
Olfr785 A G 10: 129,410,040 R225G possibly damaging Het
Olfr873 T C 9: 20,300,452 I85T possibly damaging Het
Pcdhb6 A G 18: 37,336,300 D758G probably benign Het
Pkp4 G A 2: 59,318,512 W536* probably null Het
Polr3b C T 10: 84,631,789 L78F possibly damaging Het
Rasa4 T A 5: 136,100,982 V272E possibly damaging Het
Syne2 A G 12: 75,994,075 T3836A possibly damaging Het
Tbpl2 C T 2: 24,076,058 V308I possibly damaging Het
Tcea1 T A 1: 4,891,918 I176K probably damaging Het
Try5 A T 6: 41,312,380 F87L probably benign Het
Ttc8 G T 12: 98,976,433 G411* probably null Het
Vmn2r115 G A 17: 23,345,178 W108* probably null Het
Zdhhc13 C T 7: 48,826,880 T581I probably benign Het
Zfp777 G T 6: 48,044,256 T144K probably benign Het
Other mutations in Apcdd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Apcdd1 APN 18 62933865 splice site probably benign
IGL01522:Apcdd1 APN 18 62952115 missense possibly damaging 0.50
IGL01637:Apcdd1 APN 18 62937286 missense probably damaging 1.00
IGL02069:Apcdd1 APN 18 62949983 missense probably damaging 1.00
IGL02183:Apcdd1 APN 18 62951854 missense probably damaging 0.98
IGL02268:Apcdd1 APN 18 62950188 missense probably damaging 0.99
IGL02664:Apcdd1 APN 18 62951820 splice site probably benign
R0207:Apcdd1 UTSW 18 62950079 missense probably benign 0.04
R0363:Apcdd1 UTSW 18 62937097 missense possibly damaging 0.46
R0540:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0567:Apcdd1 UTSW 18 62934036 missense possibly damaging 0.93
R0607:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0629:Apcdd1 UTSW 18 62933970 missense probably damaging 1.00
R1118:Apcdd1 UTSW 18 62952024 missense probably benign
R1178:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1180:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1181:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R4363:Apcdd1 UTSW 18 62951932 missense possibly damaging 0.95
R5534:Apcdd1 UTSW 18 62937034 missense probably benign 0.01
R5622:Apcdd1 UTSW 18 62936902 splice site probably null
R5771:Apcdd1 UTSW 18 62936956 missense probably damaging 1.00
R5852:Apcdd1 UTSW 18 62937063 missense probably damaging 1.00
R5934:Apcdd1 UTSW 18 62951869 missense possibly damaging 0.72
R6109:Apcdd1 UTSW 18 62937366 missense probably damaging 1.00
R6515:Apcdd1 UTSW 18 62951839 missense probably damaging 1.00
R6625:Apcdd1 UTSW 18 62951858 missense probably damaging 1.00
R6831:Apcdd1 UTSW 18 62950126 nonsense probably null
R6931:Apcdd1 UTSW 18 62933908 missense probably damaging 1.00
R7018:Apcdd1 UTSW 18 62937049 missense probably damaging 0.98
R7115:Apcdd1 UTSW 18 62936953 missense probably damaging 1.00
R7148:Apcdd1 UTSW 18 62951845 missense probably damaging 1.00
R7326:Apcdd1 UTSW 18 62952188 nonsense probably null
R8025:Apcdd1 UTSW 18 62936908 missense probably damaging 1.00
R8114:Apcdd1 UTSW 18 62950056 missense probably damaging 1.00
R8261:Apcdd1 UTSW 18 62933903 missense possibly damaging 0.86
R8404:Apcdd1 UTSW 18 62933915 missense possibly damaging 0.66
R9015:Apcdd1 UTSW 18 62950086 missense possibly damaging 0.93
R9040:Apcdd1 UTSW 18 62937343 missense probably damaging 0.96
R9288:Apcdd1 UTSW 18 62922660 start gained probably benign
R9295:Apcdd1 UTSW 18 62922660 start gained probably benign
R9297:Apcdd1 UTSW 18 62922660 start gained probably benign
R9317:Apcdd1 UTSW 18 62922660 start gained probably benign
R9319:Apcdd1 UTSW 18 62922660 start gained probably benign
R9393:Apcdd1 UTSW 18 62922660 start gained probably benign
R9394:Apcdd1 UTSW 18 62922660 start gained probably benign
R9396:Apcdd1 UTSW 18 62922660 start gained probably benign
X0028:Apcdd1 UTSW 18 62937130 missense possibly damaging 0.59
Z1088:Apcdd1 UTSW 18 62937183 missense probably benign 0.18
Z1177:Apcdd1 UTSW 18 62922691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTACCTCTGAGCTGTGCAC -3'
(R):5'- TTCCAGAAAGAACACTGCAGCG -3'

Sequencing Primer
(F):5'- GCTGCGGTTCGGAGTCC -3'
(R):5'- AAAACCACTGCGGGTGC -3'
Posted On 2022-04-18