Incidental Mutation 'R9398:Ubqln5'
ID 710941
Institutional Source Beutler Lab
Gene Symbol Ubqln5
Ensembl Gene ENSMUSG00000055643
Gene Name ubiquilin 5
Synonyms 4931431F19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R9398 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 104127912-104129826 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 104128778 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 280 (T280A)
Ref Sequence ENSEMBL: ENSMUSP00000062054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053743] [ENSMUST00000138055]
AlphaFold Q9D4I8
PDB Structure Solution Structure of RSGI RUH-016, a UBA Domain from mouse cDNA [SOLUTION NMR]
Solution Structure of the N-terminal Ubiquitin-like Domain in the 4931431F19Rik Protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000053743
AA Change: T280A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000062054
Gene: ENSMUSG00000055643
AA Change: T280A

DomainStartEndE-ValueType
UBQ 24 94 7.97e-13 SMART
low complexity region 365 376 N/A INTRINSIC
UBA 468 506 2.14e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvrl1 A T 15: 101,137,043 K228* probably null Het
Adrb2 T C 18: 62,179,205 D183G probably benign Het
Ap1m2 A G 9: 21,305,639 Y134H probably damaging Het
Arid5a A G 1: 36,318,992 T217A probably benign Het
Cdnf C T 2: 3,521,038 T89I possibly damaging Het
Cntnap3 G A 13: 64,903,834 R3W probably benign Het
Col6a6 A G 9: 105,774,626 I1062T probably benign Het
Ctss T C 3: 95,546,947 F270S possibly damaging Het
Ddhd1 C T 14: 45,657,660 G118R possibly damaging Het
Ddx11 A G 17: 66,129,917 K69E probably benign Het
Dgkb G A 12: 38,139,658 G328D probably damaging Het
Dock1 C T 7: 135,172,499 T1852M probably damaging Het
Gm19410 T C 8: 35,805,202 Y1346H probably benign Het
Gm6614 A G 6: 141,994,785 S137P possibly damaging Het
Gprin1 G T 13: 54,739,570 T297N probably damaging Het
Gramd1c A G 16: 44,013,018 F187S probably damaging Het
Gse1 A G 8: 120,576,335 N1072D unknown Het
Gtf3c6 G A 10: 40,257,524 probably benign Het
Hipk3 T A 2: 104,433,217 T897S probably benign Het
Igsf21 T A 4: 140,246,451 probably benign Het
Itgb1 A G 8: 128,726,124 I757V probably damaging Het
Lamb2 C T 9: 108,487,167 R1102W possibly damaging Het
Lzts2 T G 19: 45,024,769 C374W unknown Het
Mapk10 A T 5: 102,913,286 S462T probably damaging Het
Mtcl1 A T 17: 66,448,467 D293E possibly damaging Het
Nf1 T G 11: 79,547,192 H109Q probably damaging Het
Nlrp9b T C 7: 20,049,510 L926P probably damaging Het
Notch2 G A 3: 98,102,352 D532N probably damaging Het
Olfm4 A T 14: 80,011,809 Y122F probably benign Het
Olfr1001-ps1 T C 2: 85,634,023 V198A probably benign Het
Olfr141 A G 2: 86,806,816 L61P possibly damaging Het
Olfr502 T C 7: 108,523,828 T41A probably damaging Het
Olfr569 A G 7: 102,887,793 M120T probably damaging Het
Olfr603 T A 7: 103,383,280 T241S probably damaging Het
Olfr684 A T 7: 105,156,799 Y294* probably null Het
P2rx2 A T 5: 110,340,272 M472K probably benign Het
Pbxip1 A G 3: 89,447,634 K487E probably benign Het
Plxnb2 A G 15: 89,160,919 V1108A probably benign Het
Polq A G 16: 37,061,032 N1186S probably benign Het
Por T A 5: 135,725,743 W6R unknown Het
Prex2 G A 1: 11,136,804 V529I probably benign Het
Rgs6 T G 12: 82,651,841 S5A probably benign Het
Rp9 G T 9: 22,448,786 S171* probably null Het
Sec11c T A 18: 65,809,497 I47N possibly damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GACCAGCTCAGCCACGGG GACCAGCTCAGCCACGGGTACCAGCTCAGCCACGGG 7: 126,467,574 probably benign Het
Sh2b1 GCCACGGGGACCAGCTC GCCACGGGGACCAGCTCATCCACGGGGACCAGCTC 7: 126,467,584 probably benign Het
Sorcs1 A G 19: 50,225,213 M692T possibly damaging Het
Sult1d1 T A 5: 87,566,095 Q30L probably benign Het
Tcea2 A G 2: 181,680,450 D15G probably damaging Het
Tep1 T C 14: 50,828,972 S2344G possibly damaging Het
Ttc6 T A 12: 57,737,618 Y1824* probably null Het
Ush1c T C 7: 46,220,510 R342G probably benign Het
Vmn1r185 T A 7: 26,611,631 I150F probably benign Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn1r86 A G 7: 13,102,334 M205T probably damaging Het
Vps13d A T 4: 145,170,386 Y321* probably null Het
Other mutations in Ubqln5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Ubqln5 APN 7 104128427 missense possibly damaging 0.83
IGL02127:Ubqln5 APN 7 104129482 missense probably damaging 0.99
IGL02565:Ubqln5 APN 7 104129072 nonsense probably null
R1181:Ubqln5 UTSW 7 104128741 missense probably damaging 0.99
R1962:Ubqln5 UTSW 7 104128888 missense possibly damaging 0.83
R1962:Ubqln5 UTSW 7 104128927 missense probably damaging 0.98
R1964:Ubqln5 UTSW 7 104128888 missense possibly damaging 0.83
R1992:Ubqln5 UTSW 7 104129534 missense probably damaging 1.00
R1998:Ubqln5 UTSW 7 104128741 missense probably damaging 0.99
R3927:Ubqln5 UTSW 7 104128471 missense probably damaging 1.00
R4831:Ubqln5 UTSW 7 104129622 intron probably benign
R5699:Ubqln5 UTSW 7 104129425 missense possibly damaging 0.78
R5840:Ubqln5 UTSW 7 104128954 missense possibly damaging 0.83
R5858:Ubqln5 UTSW 7 104128811 missense probably benign 0.17
R5907:Ubqln5 UTSW 7 104128574 missense possibly damaging 0.55
R6477:Ubqln5 UTSW 7 104128258 missense probably damaging 0.97
R6602:Ubqln5 UTSW 7 104129489 missense probably benign 0.07
R6919:Ubqln5 UTSW 7 104129008 missense probably benign 0.15
R6981:Ubqln5 UTSW 7 104128601 missense probably benign 0.29
R8153:Ubqln5 UTSW 7 104128804 missense possibly damaging 0.52
R8712:Ubqln5 UTSW 7 104129115 missense probably benign 0.04
R8787:Ubqln5 UTSW 7 104129122 missense probably benign 0.01
X0028:Ubqln5 UTSW 7 104129408 missense probably damaging 1.00
Z1088:Ubqln5 UTSW 7 104128971 missense possibly damaging 0.83
Z1176:Ubqln5 UTSW 7 104128918 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GTGCCAGAGATGGATTCTGCTG -3'
(R):5'- TATGCATCCCAGCTGCTCTG -3'

Sequencing Primer
(F):5'- AGATGGATTCTGCTGCAGGAC -3'
(R):5'- TGATATCCATCAGGTCATGCTC -3'
Posted On 2022-04-18